نتایج جستجو برای: six primer pairs pb
تعداد نتایج: 475275 فیلتر نتایج به سال:
Transmissible plasmids are responsible for the spread of genetic determinants, such as antibiotic resistance or virulence traits, causing a large ecological and epidemiological impact. Transmissible plasmids, either conjugative or mobilizable, have in common the presence of a relaxase gene. Relaxases were previously classified in six protein families according to their phylogeny. Degenerate pri...
UNLABELLED PREMISE OF THE STUDY We developed microsatellite markers in the legume Lens culinaris from publicly available databases to enrich the limited marker resource available for the crop. • METHODS AND RESULTS Eighty-two primer sets were identified using expressed sequence sets of L. culinaris available in the National Center for Biotechnology Information (NCBI) database and were char...
Axonopus compressus (Sw.) Beauv. is a perennial herb widely used as a garden lawn grass. In this study, we used Roche 454 pyrosequencing, combined with the magnetic bead enrichment method FIASCO, to isolate simple sequence repeat markers from the A. compressus genome. A total of 1942 microsatellite loci were identified, with 53,193 raw sequencing reads. One hundred micro-satellite loci were sel...
Here, we report the results of next-generation sequencing on the GS Junior system to identify a large number of microsatellites from the epiphytic moss Orthotrichum speciosum. Using a combination of a total (non-enrichment) genomic library and small-scale 454 pyrosequencing, we determined 5382 contigs whose length ranged from 103 to 5445 bp. In this dataset we identified 92 SSR (simple sequence...
the hla class ii genes of human major histocompatibility complex (mhc) exhibit an extensive degree of genetic polymorphism. this region subdivides into four sub-regions dp, do, dq, and dr. there are five different dr haplotypes that all contain a highly polymorphic allele called hla-drb1. in most recent studies, the association between hla-drb1 and a large number of diseases such as multiple sc...
A Y chromosomal polymorphic markers screening strategy using a multiplex polymerase chain reaction (PCR) and DNA microchip electrophoresis technology has recently been developed. It is a part of the human Y chromosome haplotyping system for studying Japanese population genetics and its relationship with male spermatogenic failure. This strategy is based on optimizing and modifying the primer se...
UNLABELLED We developed a CGI/Perl-based web server to perform in silico polymerase chain reaction (PCR) on PCR primer sequences. The PUNS (Primer-UniGene Selectivity) server simulates PCR reactions by running BLASTN analysis on user-entered primer pairs against both the transcriptome and the genome to assess primer specificity. PUNS is particularly suited for the identification of highly selec...
CT140 RFLP Probe: Four primers were designed from the CT140 RFLP probe: PCT140F1, PCT140F2, PCT140R1 and PCT140R2 (Table 1). All four primer combinations gave the strongest bands of 750 bp with Heinz 1706 DNA (Fig. 2). Primer pairs PCT140F1/PCT140R1 and PCT140F2/PCT140R2 gave two bands. Primer pairs PCT140F1/PCT140R2 and PCT140F2/PCT140R1 gave a single band. The primer pair PCT140F2/PCT140R1 ga...
BACKGROUND DNA barcoding is a popular tool in taxonomic and phylogenetic studies, but for most animal lineages protocols for obtaining the barcoding sequences--mitochondrial cytochrome C oxidase subunit I (cox1 AKA CO1)--are not standardized. Our aim was to explore an optimal strategy for arachnids, focusing on the species-richest lineage, spiders by (1) improving an automated DNA extraction pr...
Technical Appendix Table. PCR primer pairs used to recover whole-genome sequences of gemycircularviruses Primer pair Forward primer sequence 5′3′ Reverse primer sequence 5′3′ HV-GcV1–1 TTATATGCCCAGACGGACCC ATTGTGCGGCGGATAGGATA HV-GcV1–2 CGAATTTAACCCCGGATGCA AAGGATGCCACCCGAATGTA HV-GcV1–3 TTGTTCGATCAGACCACCGA GTTCCTTCCGAGCTACAAGT HV-GcV1–4 TCGATGTTAACTCCCTCCGG GAAACGTGTAGATCGGCGAC HV-GcV2–1 TT...
نمودار تعداد نتایج جستجو در هر سال
با کلیک روی نمودار نتایج را به سال انتشار فیلتر کنید