In a young male with Fanconi's anaemia, 10% of cells in a direct bone marrow preparation had chromosome abnormalities. Breaks involving primarily groups B and C members constituted the most frequent changes encountered, while 2 cells had either a dicentric or a ring chromosome. Smears from the same aspirate showed anaphase bridges in 3oo of mitoses. It is suggested that in this disease chromoso...

Objective Approximately 15 percent of couples are infertile. The male factor is responsible for approximately 50% of the cases. One of the main genetic factors playing a role in male infertility is Y chromosomal microdeletion within the proximal long arm of the Y chromosome (Yq11), named azoospermia factor (AZF) region. Recent studies have also demonstrated that there is a potential connection ...

A case of maternal uniparental disomy of chromosome 13 is described. The subject is a phenotypically normal male who inherited a t(13;13)(p11.2;p11.2) from his mother who is a carrier of this translocation. The mother was ascertained through a history of recurrent abortion and is phenotypically normal. The translocation in both subjects was studied by cytogenetic and DNA analysis and appears to...

Background: Lymphocyte-dicentric assay is the most generally accepted method for biological dosimetry of overexposed individuals. In this study, the frequency of unstable chromosome aberration in blood lymphocytes was used to estimate radiation dose received by individuals. Evaluation of dose using a calibration curve produced elsewhere may have a significant uncertainty therefore, experiments ...

It has been established that the Y chromosome carries genes required for spermatogenesis and male fertility. For many decades worldwide screening for gene identification has been conducted in research laboratories. However, it has been a difficult process in identifying such genes (i.e. causative mutations) which could explain the phenotypic variation and could be potentially used as markers fo...

We report on a newborn white male infant with marked dysmorphic features and various congenital malformations. The initial clinical evaluation showed Crouzon-like features as well as some features of trisomy 18 syndrome and trisomy 13 syndrome. The results from conventional cytogenetic analysis showed a structurally abnormal chromosome replacing one normal chromosome 18, but only by applying mo...

A double-stranded 9 bp GTGAAAAAG pJ alpha sequence found in human centromeric alpha-satellite DNA and a 28 bp ATGTATATATGTGTATATAGACATAAAT tandemly repeated AT28 sequence found within a cloned neo- centromere DNA have each allowed the affinity purification of a nuclear protein that we have identified as poly(ADP-ribose) polymerase (PARP). Use of other related or unrelated oligonucleotide sequen...