The phylogenetic relationships between Bombyx mori and Bombyx mandarina species of Bombycidae, and Antheraea yamamai and Antheraea pernyi species of Saturniidae were investigated based on mtDNA RFLP and cytochrome oxidase I gene. The sizes of the mtDNA of all the species were estimated at approximately 16 kbp +/- 500 bp by total length of all the restricted fragments and no variation in size wa...

We discovered a novel iflavirus from the transcriptome of the Bombyx mori pupa inoculated with the insect-pathogenic fungus Cordyceps militaris. The assembled iflavirus genome has 10,119 nucleotides, with a 3'-polyadenylated tail, and it encodes a polyprotein composed of 3,004 amino acids.

The draft genome sequence of Sphingomonas paucimobilis host index number (HER) 1398, host of the giant PAU phage isolated from silk moths (Bombyx mori), indicates that this isolate belongs within the genus Sphingobacterium. We suggest that Sphingomonas paucimobilis strain HER1398 be reclassified as Sphingobacterium paucimobilis strain HER1398.

BACKGROUND The vitellogenin receptor (VgR) mediates the uptake of vitellogenin (Vg) from the hemolymph by developing oocytes. RESULTS VgR with the mutational EGF1 domain can bind ligand proteins but cannot be dissociated under acidic conditions. The mutant is lethal in embryos. CONCLUSION Bombyx mori VgR (BmVgR) has an important role in egg formation and embryonic development. SIGNIFICANC...

We report a draft sequence for the genome of the domesticated silkworm (Bombyx mori), covering 90.9% of all known silkworm genes. Our estimated gene count is 18,510, which exceeds the 13,379 genes reported for Drosophila melanogaster. Comparative analyses to fruitfly, mosquito, spider, and butterfly reveal both similarities and differences in gene content.

SEQUENCE AND ITS ORIGIN: 240 bp of pBma5, a -2.8 kb //mdlll-fiamHI fragment subcloned in pBR327. The fragment is derived from the 10.4 kb insert of the lambda recombinant I^Ad isolated from a Bombyx mori genomic library (Fig. 1 of Fournier et al., 1984). . 60 AAGCTTTGTAGTATAATTTCGTCAGTTCATAATCCTCCTGGTATGTATGAAGATTTTCTT . 120 TTGAAAACCTATCAGCTATTTTTAACGGTAGTGGATAGCCCGGCTAGCTCAGTCGGTAGA . 180 GCA...

The fine structure of Bombyx mori silk fibroin was investigated by electron microscopy and X-ray diffraction techniques. Examination of silk fibers fragmented with ultrasonic radiation and negatively stained revealed the presence of ribbon-like filaments of well-defined lateral dimensions. Analysis of the breadths of the equatorial reflections in the X-ray diffraction pattern of fibroin yielded...

The Bombyx mori (Lepidoptera: Bombycidae) midgut undergoes remodeling during the larval-pupal metamorphosis. All metamorphic events in insects are controlled by mainly two hormones: 20-hydroxyecdysone (20E) and juvenile hormone (JH). Fenoxycarb, O-ethyl N-(2-(4-phenoxyphenoxy)-ethyl) carbamate, has been shown to be one of the most potent juvenile hormone analogs against a variety of insect spec...