نتایج جستجو برای: impedimetric
تعداد نتایج: 396 فیلتر نتایج به سال:
This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, l-leucine; R, l-arginine) (MC-LR) containing 5? thiolated 60-mer DNA aptamer (i.e., 5?-SH-(CH2)6GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCT CCGC-3?). A nanocomposite electrode platform comprising biocompatible poly(2,5-dimethoxyaniline) (PDMA)-poly(vinylsulfonate) (PVS) and silver nanoparticle...
We report on the aptadetection of chloramphenicol (CAP) using electrochemical impedance spectroscopy. The detection principle is based on the changes of the interfacial properties of the electrode after the interaction of the ssDNA aptamers with the target molecules. The electrode surface is partially blocked due to the formation of the aptamer-CAP complex, resulting in an increase of the inter...
An amplified impedimetric aptasensor combining target-induce DNA Hydrogel formation with pH-stimulated signal amplification for heparanase assay Zhe-Han Yang, Ying Zhuo, Ruo Yuan*, Ya-Qin Chai* Key Laboratory of Luminescent and Real-Time Analytical Chemistry (Southwest University), Ministry of Education, College of Chemistry and Chemical Engineering, Southwest University, Chongqing 400715, PR C...
We designed a novel 6-point electrochemical impedance spectroscopy (EIS) sensor with 15 combinations of permutations for the 3-D mapping and detection of metabolically active atherosclerotic lesions. Two rows of 3 stretchable electrodes circumferentially separated by 120° were mounted on an inflatable balloon for intravascular deployment and endoluminal interrogation. The configuration and 15 p...
نمودار تعداد نتایج جستجو در هر سال
با کلیک روی نمودار نتایج را به سال انتشار فیلتر کنید