pRSgap (Supplementary Figure 3B) was constructed from pBluescriptII SK+ (Stratagene) by inserting 4 PCR fragments derived from λ-DNA into the multiple cloning site of the vector. PCR fragment 1 (forward primer: AAAATCTAGAAGTTCAGGAAGCGGTGATGCTG, reverse primer AAAAGAGCTCTTGGGCGGTTGTGTACATCGAC) copies the 4236 to 6137 bp region from λ-DNA. After digestion with the corresponding restriction enzyme...

AmpC is a class C Ambler β-lactamase that confers resistance to cephamycins. Globally reported AmpC-producing Enterobacterales are clinically important due their therapeutic restrictions and epidemiology. Between April 2021 May 2021, an outbreak of beta-lactamase-producing Escherichia coli occurred at Showa University Hospital. Because this outbreak, plasmid typing, enterobacterial repetitive i...

Salmonella Enteritidis (SE) is a genetically homogenous serovar, which makes optimal subtype discrimination crucial for epidemiological research. This study describes the development and evaluation of an optimized multiple-locus variable number tandem-repeat assay (MLVA) for characterization of SE. The typeability and discriminatory power of this MLVA was determined on a selected collection of ...

INTRODUCTION One approach to control enterotoxigenic Escherichia coli (ETEC) infections has been to develop vaccines focused on inducing protective immunity against surface expressed antigenic factors. One such factor is coli surface antigen 6 (CS6); ETEC isolates expressing CS6 may also simultaneously co-express surface antigens CS4 or CS5. However, there is little information regarding the in...

Background: Respiratory infection with Pseudomonas aeruginosa is very common in patients with cystic fibrosis (CF) but antimicrobial resistance rates of CF isolates across the UK are largely unknown. Methods: The susceptibility of 417 CF patient isolates of P aeruginosa from 17 hospitals to six commonly prescribed antibiotics were examined. Isolates were tested by an agar break point dilution m...

INTRODUCTION The aim of this study was the long-term prospective evaluation of the effects of estroprogestagen (EP) therapy on the bone mineral density (BMD) of girls with functional hypothalamic amenorrhea (FHA) carrying various PvuII and XbaI polymorphisms of ER-α. MATERIAL AND METHODS Prospective observation included 84 FHA girls and 50 controls. The FHA patients were subjected to 4-year s...

Two separate animal populations consisting of a herd of cattle (19 animals) and a flock of sheep (25 animals) were investigated for strains of Escherichia coli producing Shiga toxins (STEC) over a time period of 6 months. Thirty-three STEC were isolated from 63.2% of cattle and grouped into 11 serotypes and eight electrophoretic types (ETs) by multilocus enzyme analysis. In sheep, 88% of the an...

Salmonella enterica serovar Heidelberg strains are frequently associated with food-borne illness, with recent isolates showing higher rates of resistance to multiple antimicrobial agents. One hundred eighty S. enterica serovar Heidelberg isolates, collected from turkey-associated production and processing sources, were tested for antimicrobial susceptibility and compared by pulsed-field gel ele...

OBJECTIVE To investigate whether single-nucleotide polymorphisms (SNPs) within the estrogen receptor (ER) alpha and Beta genes are associated with disease susceptibility and clinical presentation in Japanese patients with systemic sclerosis (SSc). METHODS Three SNPs, ERalpha PvuII T/C, ERalpha XbaI A/G, and ERBeta RsaI G/A, were genotyped using polymerase-chain reaction combined with restrict...

Twenty-one Escherichia coli O157:H7 strains isolated in northern Italy from sporadic cases of hemolytic-uremic syndrome and from cattle and food were characterized by virulence gene analysis, pulsed-field gel electrophoresis (PFGE) of XbaI-digested DNA, enterobacterial repetitive intergenic consensus (ERIC) sequence-based PCR (ERIC-PCR), and antibiotic resistance patterns and compared to 18 str...