A new ab initio pair potential for water was generated by fitting 2510 interaction energies computed by the use of symmetry-adapted perturbation theory ~SAPT!. The new site–site functional form, named SAPT-5s, is simple enough to be applied in molecular simulations of condensed phases and at the same time reproduces the computed points with accuracy exceeding that of the elaborate SAPT-pp funct...

The assembly of eukaryotic ribosomes is a hierarchical process involving about 200 biogenesis factors and a series of remodeling steps. The 5S RNP consisting of the 5S rRNA, RpL5 and RpL11 is recruited at an early stage, but has to rearrange during maturation of the pre-60S ribosomal subunit. Rpf2 and Rrs1 have been implicated in 5S RNP biogenesis, but their precise role was unclear. Here, we p...

Ribosomal DNA in sturgeon is informative when analyzed at the molecular level because it bears unique characteristics that are, to a certain extent, ancestral within vertebrates. In this paper, we examine the structure and the molecular evolution of the 5S ribosomal DNA (rDNA) region in 13 sturgeon species, comparing both the 5S ribosomal RNA (rRNA) genes and the non-transcribed spacer (NTS) se...

We investigated the locations of 5S and 45S rDNA in Gossypium diploid A, B, D, E, F, G genomes and tetraploid genome (AD) using multi-probe fluorescent in situ hybridization (FISH) for evolution analysis in Gossypium genus. The rDNA numbers and sizes, and synteny relationships between 5S and 45S were revealed using 5S and 45S as double-probe for all species, and the rDNA-bearing chromosomes wer...

A general secondary structure is proposed for the 5S RNA of prokaryotic ribosomes, based on helical energy filtering calculations. We have considered all secondary structures that are common to 17 different prokaryotic 5S RNAs and for each 5S sequence calculated the (global) minimum energy secondary structure (300,000 common structures are possible for each sequence). The 17 different minimum e...

We review all instances in which the nuclear 5S rRNA genes of fungi, protist, nematode, and arthropod species have been reported to be linked to the tandemly repeated units of the rDNA, trans-spliced leader, and histone multigene families. The evolution of these gene arrangements is analyzed by mapping them to independently derived phylogenies. These analyses show that 5S rRNA genes have repeat...

The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).

THE PURPOSE. Consider the introduction and implementation of lean production technology in branches OOO Tatneft - AZS Center. Describe essence technology, consider problems, complexity propose an algorithm for introducing involving each employee process optimizing business maximizing customer focus. METHODS. At initial stage, it was decided to start implementing Lean philosophy with two its too...

A novel nested PCR assay was developed to detectRickettsiaspp. in ticks and tissue samples from humans and laboratory animals. Primers were designed for the nested run to amplify a variable region of the 23S-5S intergenic spacer (IGS) ofRickettsiaspp. The newly designed primers were evaluated using genomic DNA from 11Rickettsiaspecies belonging to the spotted fever, typhus, and ancestral groups...

The chromatin-remodelling complex B-WICH, comprised of William syndrome transcription factor, the ATPase SNF2h and nuclear myosin, specifically activates RNA polymerase III transcription of the 5S rRNA and 7SL genes. However, the underlying mechanism is unknown. Using high-resolution MN walking we demonstrate here that B-WICH changes the chromatin structure in the vicinity of the 5S rRNA and 7S...