Lactogenic hormone regulation of beta-casein gene expression in mammary epithelial cells provides an excellent model in which to study the mechanisms by which steroid and peptide hormone signaling control gene expression. Prolactin- and glucocorticoid-mediated induction of beta-casein gene expression involves two principal regulatory regions, a proximal promoter and a distal enhancer located in...

The ability to separate the isoforms of human tumour suppressor protein p53 expressed in insect cells using heparin-Sepharose correlates with differences in the isoelectric point of p53, demonstrating that p53 can be heterogeneously modified and providing support for the use of insect cells as a model system for identifying novel signalling pathways that target p53. One p53 isoform that was red...

The diverse roles of TopBP1 in DNA replication and checkpoint signaling are associated with the scaffolding ability of TopBP1 to initiate various protein-protein interactions. The recognition of the BACH1/FANCJ helicase by TopBP1 is critical for the activation of the DNA replication checkpoint at stalled replication forks and is facilitated by the C-terminal tandem BRCT7/8 domains of TopBP1 and...

The initiation factor eIF5A in Trichomonas vaginalis (TveIF5A) is previously shown to undergo hypusination, phosphorylation and glycosylation. Three different pI isoforms of TveIF5A have been reported. The most acidic isoform (pI 5.2) corresponds to the precursor TveIF5A, whereas the mature TveIF5A appears to be the most basic isoform (pI 5.5). In addition, the intermediary isoform (pI 5.3) is ...

Accurate quantification and enumeration of peptide motifs is hampered by redundancy in peptide identification. A single phosphorylation motif may be split across charge states, alternative modifications (e.g. acetylation and oxidation), and multiple miss-cleavage sites which render the biological interpretation of MS data a challenge. In addition motif redundancy can affect quantitative and sta...

Vancomycin inhibits the synthesis of peptidoglycan in membrane preparations from Gaffkya homari with uridine diphosphate-N-acetylmuramyl (UDP-Mur-NAc)-pentapeptide as substrate, but not with either UDP-MurNAc-tetrapeptide or UDP-MurNAc-tripeptide. These results are correlated with the specificity studies described by Perkins and Nieto for complex formation between the antibiotic and the peptide...

Name of the Sequence. River buffalo kappa-casein cDNA. Genus and Species. Bubalus arnee bubalis. Origin of the Clone. Ten micrograms of total RNA from mammary tissue of lactating buffalo was reverse-transcribed using an oligo d(T)17 primer and superscript II reverse transcriptase (GIBCO-BRL, Grand Island, NY). The forward primer (5′GTGACAAGGAAAGGTGCAATG3′) was designed from conserved regions, t...

Extracts of HeLa cell fractions were analyzed by DEAE- and phospho-cellulose chromatography for their range of cyclic AMP-dependent and -independent protein kinase activities phosphorylating histone and/or phosvitin; extractions were by phosphate buffered saline (soluble protein kinases) and the non-ionic detergent NP-40 (membrane-bound protein kinases). The soluble fraction contained (i) cycli...