نتایج جستجو برای: نظام ارزیابی سیستم 5s

تعداد نتایج: 223021  

Journal: :iranian chemical communication 2014
hamid saeidian dieter enders zohreh mirjafary

4s-ferrugineone and 4s,5s-ferrugineol as pheromones of palm weevils were synthesized in 3 and 4 steps, respectively, starting from nonane-5-one employing samp-/ramp -hydrazone methodology. 5-nonanone is transformed to its corresponding ramp hydrazone by reaction with the enantiomerically pure hydrazine ramp. metalation with lithium diisopropylamide (lda) in ether to form azaenolate, followed by...

Journal: :Genes & genetic systems 2005
Satoshi Kitamura Atsushi Tanaka Masayoshi Inoue

We used the intergenic spacer sequences of the 5S ribosomal RNA genes (5S rDNA) to obtain insights into the genomic origin of putative amphidiploid/tetraploid species with 2n = 48 and their descendants in Nicotiana. Amplification of the spacer sequences and subsequent multiple alignment using the consensus sequences from each species, showed that two Australian species shared common large delet...

2000
Eric M. Mas Robert Bukowski Krzysztof Szalewicz Gerrit C. Groenenboom Paul E. S. Wormer

A new ab initio pair potential for water was generated by fitting 2510 interaction energies computed by the use of symmetry-adapted perturbation theory ~SAPT!. The new site–site functional form, named SAPT-5s, is simple enough to be applied in molecular simulations of condensed phases and at the same time reproduces the computed points with accuracy exceeding that of the elaborate SAPT-pp funct...

2015
Satyavati Kharde Fabiola R. Calviño Andrea Gumiero Klemens Wild Irmgard Sinning

The assembly of eukaryotic ribosomes is a hierarchical process involving about 200 biogenesis factors and a series of remodeling steps. The 5S RNP consisting of the 5S rRNA, RpL5 and RpL11 is recruited at an early stage, but has to rearrange during maturation of the pre-60S ribosomal subunit. Rpf2 and Rrs1 have been implicated in 5S RNP biogenesis, but their precise role was unclear. Here, we p...

Journal: :Nucleic acids research 1995
T P Smith L S Young L B Bender K U Sprague

We find striking similarities in promoter structure and requirements for template commitment on 5S RNA and tRNA genes from silkworms. The promoters are nearly the same size (approximately 160 bp) and include flanking as well as internal sequences. To analyze the factor requirements for 5S RNA transcription complex assembly in a completely homologous system, we have isolated a silkworm fraction ...

Journal: :Genome 2005
Francisca Robles Roberto de la Herrán Arne Ludwig Carmelo Ruiz Rejón Manuel Ruiz Rejón Manuel A Garrido-Ramos

Ribosomal DNA in sturgeon is informative when analyzed at the molecular level because it bears unique characteristics that are, to a certain extent, ancestral within vertebrates. In this paper, we examine the structure and the molecular evolution of the 5S ribosomal DNA (rDNA) region in 13 sturgeon species, comparing both the 5S ribosomal RNA (rRNA) genes and the non-transcribed spacer (NTS) se...

2013
Yimei Gan Fang Liu Dan Chen Qiong Wu Qin Qin Chunying Wang Shaohui Li Xiangdi Zhang Yuhong Wang Kunbo Wang

We investigated the locations of 5S and 45S rDNA in Gossypium diploid A, B, D, E, F, G genomes and tetraploid genome (AD) using multi-probe fluorescent in situ hybridization (FISH) for evolution analysis in Gossypium genus. The rDNA numbers and sizes, and synteny relationships between 5S and 45S were revealed using 5S and 45S as double-probe for all species, and the rDNA-bearing chromosomes wer...

Journal: :Nucleic acids research 1981
G M Studnicka F A Eiserling J A Lake

A general secondary structure is proposed for the 5S RNA of prokaryotic ribosomes, based on helical energy filtering calculations. We have considered all secondary structures that are common to 17 different prokaryotic 5S RNAs and for each 5S sequence calculated the (global) minimum energy secondary structure (300,000 common structures are possible for each sequence). The 17 different minimum e...

Journal: :Molecular biology and evolution 1995
G Drouin M M de Sá

We review all instances in which the nuclear 5S rRNA genes of fungi, protist, nematode, and arthropod species have been reported to be linked to the tandemly repeated units of the rDNA, trans-spliced leader, and histone multigene families. The evolution of these gene arrangements is analyzed by mapping them to independently derived phylogenies. These analyses show that 5S rRNA genes have repeat...

Journal: :Nucleic acids research 1982
F Takaiwa M Kusuda N Saga M Sugiura

The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).

نمودار تعداد نتایج جستجو در هر سال

با کلیک روی نمودار نتایج را به سال انتشار فیلتر کنید