The Praxis Project, established at University College Cork (UCC), Ireland, in 2018, seeks to assess possible models of best practice with regard the integration global citizenship and development education (GCDE) into a cross-disciplinary, cross-campus, interwoven set subject area pedagogies, policies practices. This study – first part an eventual three-part framework asserts that themes, theor...

Local geochemical background (LGB) has great importance for environmental assessment and management. In this study, 53 core soil samples were collected in 3 different sites with minimal or no human intervention to determine H.M. (Cr, Cu, Zn, Cd, Pb, Ni, Mn, As Sn) concentration pH. This study is aimed define the Geochemical Background of feralitic Vina Cameroon. determined using ICP-ES, Excel w...

Thirty five Sediment samples were collected from three Northern Egyptian Lakes namely El Burullus, Manzala and Bardawil to evaluate for the first time concentrations of poorly studied technology-critical elements, Ge, Zr, Mo, Sn, Sb, Hf, Ta, W Ti, how that may be linked local water quality parameters other geochemical factors. Inductively Coupled Plasma Mass Spectrometry (ICP-MS) was used deter...

ing with credit is permitted. To copy otherwise, to republish, to post on servers or to redistribute to lists, requires prior specific permission and/or a fee. Towards a Reading Coach that Listens: Automated Detection of Oral Reading Errors Jack Mostow, Alexander G. Hauptmann, Lin Lawrance Chase, and Steven Roth Project LISTEN, CMT-UCC 215, Carnegie Mellon University 5000 Forbes Avenue, Pittsbu...

Much of the early morphology and syntax of clause structure (until roughly age 3;0) can be described via the Optional Infinitive (OI) model (Wexler 1990, 1992, 1994), and recent versions of the theory incorporating the Unique Checking Constraint (UCC) (Wexler 1998) successfully explain variation in whether a language goes through the OI stage. The purpose of this paper is to apply the theory to...

Internet plays an important role in our lives and the number of internet users keeps increasing. As internet users are exposed to ads from online media while not knowing, advertising market’s interest in video digital ads increases. Thus, this study comparatively measured effects of video digital ads inserted in news-related video digital contents of media companies and those of video digital a...

Using in vitro labelling techniques, a tRNAGly from M. mycoides sp. capri PG3 has been shown to have the sequence : pGCAGGUGs4UAGUUUAAUGGCAGAACUUC AGCCUUCCm6AAGCUGAUUGUGAGGGU psi CGAUUCCCUUCACCUGCUCCAOH. The anticodon is UCC and no other tRNAGly has been detected in the crude tRNA isolated from this organism. As is the case with some mitochondrial tRNAs, where the genome size of the organelle i...