The present article examines two important effects that have been given scant attention in prior studies of variable risk strategies. The first effect, reference group sensitivity, is the degree to which decision makers’ aspirations are sensitive to their reference group. In this paper we compare the performances of decision makers with alternative levels of reference group sensitivity. Second,...

The increasing role of software for developing products and services requires that organizations align their software-related activities with high-level business goals. In practice, this alignment is very difficult and only little systematic support is available. GQM+Strategies is a method that aims at aligning organizational goals, strategies, and measurements at all levels of an organization ...

Although several studies have linked Life History Strategy (LHS) variation with variation in the Five Factor Model personality dimensions, no published research has explored the relationship of LHS to the HEXACO personality dimensions. The theoretically expected relationship of the HEXACO Emotionality factor to LHS is unclear. The results of two studies (N = 641) demonstrated that LHS indicator...

Mechanical ventilation is used for patients with a variety of lung diseases. Traditionally, ventilators have been designed to monotonously deliver equal sized breaths. While it may seem intuitive that lungs may benefit from unvarying and stable ventilation pressure strategy, recently it has been reported that variable lung ventilation is advantageous. In this study, we analyze the mean tidal vo...

Strategies for promoting high-efficiency homologous gene replacement have been developed and adopted for many filamentous fungal species. The next generation of analysis requires the ability to manipulate gene expression and to tag genes expressed from their endogenous loci. Here we present a suite of molecular tools that provide versatile solutions for fungal high-throughput functional genomic...

Tricho-dento-osseous syndrome (TDO) is characterised by a variable clinical phenotype primarily affecting the hair, teeth, and bone. Different clinical features are observed between and within TDO families. It is not known whether the variable clinical features are the result of genetic heterogeneity or clinical variability. A gene for TDO was localised recently to chromosome 17q21 in four Nort...

Abstract This study aims to explore the use of euphemistic strategies by Algerians and Americans when dealing with three unpleasant topics: death, lying, disease. It also examines effect degree formality on strategies. To achieve this objective, a discourse completion task (DCT) was distributed 21 Americans. The data were analysed using SPSS. analysis revealed that there are some differences si...

In the Peruvian Andes, social norms require progressive Western practices for formal situations, while traditional Andean customs suggest familiarity, even inadequacy. These ideologies transfer onto language use: in Andean linguistic ideologies, Spanish, the majority language, is standard speech and Quechua, the minority language, is non-standard (Zavala 2014). Such a perspective disregards pos...

A strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (VZV) DNA was found to be due to an insertion or deletion of DNA sequences at a single site. DNA sequence analysis showed that the nucleotide sequence CCGCCGATGGGGAGGGGGCGCGGTACC is tandemly duplicated a variable number of times in different VZV strains and is responsible for t...