نتایج جستجو برای: a psti

تعداد نتایج: 13431889  

Journal: :Journal of clinical microbiology 1997
T Deguchi M Yasuda M Nakano E Kanematsu S Ozeki Y Nishino T Ezaki S Maeda I Saito Y Kawada

To detect quinolone resistance-associated mutations within the Asp-86, Ser-87, Ser-88, and Glu-91 codons of the Neisseria gonorrhoeae parC gene, we developed a rapid and simple assay based on amplification of the regions of the parC gene containing the mutations sites by PCR and digestion of the PCR products with restriction enzymes. By using the method of primer-specified restriction site modi...

Journal: :Journal of bacteriology 1986
J R McLaughlin H C Wong Y E Ting J N Van Arsdell S Chang

The d gene from the Bacillus subtilis temperate bacteriophage SP beta was isolated. When introduced into an SP beta-sensitive strain of B. subtilis, the cloned d gene directed the synthesis of a 22-kilodalton protein and conferred on the host immunity to SP beta phage. A frameshift mutation, designated d2, was introduced into the cloned d gene, and it was subsequently crossed back into the SP b...

2011
Rafiq A. Shahid Steve S. Choi Gamze F. Karaca Timothy C. Wang Rodger A. Liddle

Pancreatic Secretory Trypsin Inhibitor 1 Reduces the Severity of 1 Chronic Pancreatitis in Mice Over-expressing Interleukin-1β in the 2 Pancreas 3 4 Joelle M.-J. Romac*, Rafiq A. Shahid*, Steve S. Choi, Gamze F. Karaca, Christoph B. 5 Westphalen, Timothy C. Wang, and Rodger A. Liddle 6 7 Department of Medicine, Duke University and Durham VA Medical Centers, North Carolina 8 27710. 9 Department ...

Journal: :Journal of clinical microbiology 2011
Kye-Hyung Kim Young Ju Choi Kyoung-Ho Song Wan Beom Park Jae-Hyun Jeon Sang-Won Park Hong Bin Kim Nam Joong Kim Myoung-Don Oh

Information about the genotype of varicella-zoster virus (VZV) is useful to monitor outbreaks of vaccine strains. However, in South Korea, where varicella vaccine was introduced in 1988, there are limited data about the genotype of VZV. VZV was isolated from vesicular lesions of patients with herpes zoster or varicella in South Korea between January 2007 and June 2009. DNAs were purified from s...

2005
A. F. Voevodin A. Lapin A. G. Tatosyan

Our previous studies have shown that hamadryas baboons of the Sukhumi "high lymphoma" stock are infected with human Tlymphotrophic virus (HTLV)-I-related virus to a significantly higher degree than baboons of different lymphoma-free populations. Levels of anti-HTLV-I-related antibodies in prelymphomatous baboon sera were also significantly higher than those in matched controls [1, 2]. These stu...

Journal: :Journal of medical genetics 1992
J C Mulley S Yu A K Gedeon A Donnelly G Turner D Loesch C J Chapman R J Gardner R I Richards G R Sutherland

The utility of the pfxa3 probe for direct molecular diagnosis of the fragile X (FRAXA) has been established. This probe detects amplification of an unstable DNA element consisting of variable length CCG repeats. The size of the amplified fragment is correlated with phenotype and was determined using PstI digested DNA in family members. In 35 families with the fragile X, there was correspondence...

Journal: :CSH protocols 2006
Joseph Sambrook David W Russell

MATERIALS 10x Amplification buffer Include 0.01% (w/v) gelatin in the buffer. 10x Bacteriophage T4 DNA ligase buffer Bacteriophage T4 DNA ligase Ethanol Optional, please see Step 5. Oligonucleotide (linker) primer (5.0 OD260/ml [approx. 17 μM]) in TE (pH 7.6) 5'CATGCTCGGTCGGGATAGGCACTGGTCTAGAG3' This oligonucleotide is identical in sequence to the 32 nucleotides at the 5' end of the oligonucleo...

2004
L. Yuan A. E. Melchinger T. Lübberstedt F. Salamini

In a previous study, two chromosome regions (Scmv1 and Scmv2), conferring sugarcane mosaic virus (SCMV) resistance in maize, were enriched with EcoRI/MseI AFLP (Eco-AFLP) markers (methylation insensitive) by targeted bulked segregant analysis (tBSA). The objective of the present study was to further saturate these two regions with PstI/MseI AFLP (Pst-AFLP) markers (methylation sensitive) using ...

نمودار تعداد نتایج جستجو در هر سال

با کلیک روی نمودار نتایج را به سال انتشار فیلتر کنید