نتایج جستجو برای: psti
تعداد نتایج: 643 فیلتر نتایج به سال:
To detect quinolone resistance-associated mutations within the Asp-86, Ser-87, Ser-88, and Glu-91 codons of the Neisseria gonorrhoeae parC gene, we developed a rapid and simple assay based on amplification of the regions of the parC gene containing the mutations sites by PCR and digestion of the PCR products with restriction enzymes. By using the method of primer-specified restriction site modi...
We developed Diversity Array Technology (DArT) markers for application in genetic studies of Brassica napus and other Brassica species with A or C genomes. Genomic representation from 107 diverse genotypes of B. napus L. var. oleifera (rapeseed, AACC genomes) and B. rapa (AA genome) was used to develop a DArT array comprising 11 520 clones generated using PstI/BanII and PstI/BstN1 complexity re...
Our previous studies have shown that hamadryas baboons of the Sukhumi "high lymphoma" stock are infected with human Tlymphotrophic virus (HTLV)-I-related virus to a significantly higher degree than baboons of different lymphoma-free populations. Levels of anti-HTLV-I-related antibodies in prelymphomatous baboon sera were also significantly higher than those in matched controls [1, 2]. These stu...
The utility of the pfxa3 probe for direct molecular diagnosis of the fragile X (FRAXA) has been established. This probe detects amplification of an unstable DNA element consisting of variable length CCG repeats. The size of the amplified fragment is correlated with phenotype and was determined using PstI digested DNA in family members. In 35 families with the fragile X, there was correspondence...
Phenotypic information about several pig meat quality traits on 334 Large White × Meishan F2 pigs was collected. Effects of the association of the FokI variants in the seventh intron of the skeletal muscle glycogen synthase (GYS1) gene and the PstI variants in the ninth intron of the palmitoyl acyl-CoA oxidase 1 (ACOX1) gene on the meat quality traits were examined on all pigs. The FokI variant...
Control of lysogeny and immunity of Bacillus subtilis temperate bacteriophage SP beta by its d gene.
The d gene from the Bacillus subtilis temperate bacteriophage SP beta was isolated. When introduced into an SP beta-sensitive strain of B. subtilis, the cloned d gene directed the synthesis of a 22-kilodalton protein and conferred on the host immunity to SP beta phage. A frameshift mutation, designated d2, was introduced into the cloned d gene, and it was subsequently crossed back into the SP b...
Pancreatic Secretory Trypsin Inhibitor 1 Reduces the Severity of 1 Chronic Pancreatitis in Mice Over-expressing Interleukin-1β in the 2 Pancreas 3 4 Joelle M.-J. Romac*, Rafiq A. Shahid*, Steve S. Choi, Gamze F. Karaca, Christoph B. 5 Westphalen, Timothy C. Wang, and Rodger A. Liddle 6 7 Department of Medicine, Duke University and Durham VA Medical Centers, North Carolina 8 27710. 9 Department ...
MATERIALS 10x Amplification buffer Include 0.01% (w/v) gelatin in the buffer. 10x Bacteriophage T4 DNA ligase buffer Bacteriophage T4 DNA ligase Ethanol Optional, please see Step 5. Oligonucleotide (linker) primer (5.0 OD260/ml [approx. 17 μM]) in TE (pH 7.6) 5'CATGCTCGGTCGGGATAGGCACTGGTCTAGAG3' This oligonucleotide is identical in sequence to the 32 nucleotides at the 5' end of the oligonucleo...
نمودار تعداد نتایج جستجو در هر سال
با کلیک روی نمودار نتایج را به سال انتشار فیلتر کنید