Here, we present the draft genome of Haladaptatus sp. strain R4, a halophilic archaea that produces an orange-pink pigment and is capable of growing in a wide salinity range. The genome assembly shows genes for arsenic resistance, siderophore production, trehalose and glycine betaine biosynthesis, uptake and transporters of sodium, potassium, and chloride ions.

The response of two marine actinomycetes such as Streptomyces sp. MADO2 and Nocardiopsis sp. MADO3 to osmotic stress in minimal medium M63 and in glycerol-asparagine medium (ISP5) was studied. The two strains were moderately halophilic and the behavior of the strain Streptomyces sp. MADO2 and Nocardiopsis sp. MADO3 towards the salt stress was varied depends on the media composition and the sali...

We have isolated five endophytic fungi from the roots of Capsicum annuum, Cucumis sativus and Glycine max. The culture filtrates (CF) of these endophytes were screened on dwarf mutant rice (Waito-C) and normal rice (Dongjin-byeo). Endophyte CAC-1A significantly inhibited the growth of Waito-C and Dongjin-byeo. Endophyte CAC-1A was identified as Paraconiothyrium sp. by sequencing the ITS rDNA re...

We have genetically replaced the native receptor binding domain of diphtheria toxin with an extended form of substance P (SP): SP-glycine (SP-Gly). The resulting fusion protein, DAB389SP-Gly, is composed of the catalytic and transmembrane domains of diphtheria toxin genetically coupled to SP-Gly. Because native SP requires a C-terminal amide moiety to bind with high affinity to the SP receptor,...

UV radiation triggers the formation of 5-thyminyl-5,6-dihydrothymine, i.e., the spore photoproduct (SP), in the genomic DNA of bacterial endospores. These SPs, if not repaired in time, may lead to genome instability and cell death. SP is mainly repaired by spore photoproduct lyase (SPL) during spore outgrowth via an unprecedented protein-harbored radical transfer pathway that is composed of at ...

The unicellular diazotrophic cyanobacterium, Cyanothece sp. ATCC 51142 temporally separates N2 fixation from photosynthesis. To better understand the processes by which photosynthesis is regulated, we have analyzed Photosystem (PS) II O2 evolution and the PSII lumenal proteins, especially the Mn stabilizing protein (MSP). We describe a procedure using glycine betaine to isolate photosynthetic m...

Using in vitro labelling techniques, a tRNAGly from M. mycoides sp. capri PG3 has been shown to have the sequence : pGCAGGUGs4UAGUUUAAUGGCAGAACUUC AGCCUUCCm6AAGCUGAUUGUGAGGGU psi CGAUUCCCUUCACCUGCUCCAOH. The anticodon is UCC and no other tRNAGly has been detected in the crude tRNA isolated from this organism. As is the case with some mitochondrial tRNAs, where the genome size of the organelle i...