نتایج جستجو برای: glycine sp

تعداد نتایج: 147011  

پایان نامه :وزارت علوم، تحقیقات و فناوری - دانشگاه کردستان - دانشکده علوم 1393

هدف این کار به دست آوردن خواص ترمودینامیکی و اثر آمینواسیدهای آلانین و گلیسین بر روی محلول های آبی پلیمری است. در بخش اول این کار، داده های تجربی فعالیت آب در دمای 15/298 کلوین برای سیستم ¬های سه-تایی (alanine + ppg400 + h2o)، (alanine + peg400 + h2o)، (alanine + peg2000 + h2o)، (alanine + peg10000 + h2o)، ((glycine + ppg400 + h2o، (glycine + peg400 + h2o)، (glycine + peg2000 + h2o) و (glycine ...

2016
Urmimala Sen Trinetra Mukherjee Sucharita Bose Chayan Roy Moidu Jameela Rameez Wriddhiman Ghosh Subhra Kanti Mukhopadhyay

Here, we present the draft genome of Haladaptatus sp. strain R4, a halophilic archaea that produces an orange-pink pigment and is capable of growing in a wide salinity range. The genome assembly shows genes for arsenic resistance, siderophore production, trehalose and glycine betaine biosynthesis, uptake and transporters of sodium, potassium, and chloride ions.

2011
Hanane Ameur Mostefa Ghoul Joseph Selvin

The response of two marine actinomycetes such as Streptomyces sp. MADO2 and Nocardiopsis sp. MADO3 to osmotic stress in minimal medium M63 and in glycerol-asparagine medium (ISP5) was studied. The two strains were moderately halophilic and the behavior of the strain Streptomyces sp. MADO2 and Nocardiopsis sp. MADO3 towards the salt stress was varied depends on the media composition and the sali...

Journal: :Molecules 2012
Abdul Latif Khan Muhammad Hamayun Javid Hussain Sang-Mo Kang In-Jung Lee

We have isolated five endophytic fungi from the roots of Capsicum annuum, Cucumis sativus and Glycine max. The culture filtrates (CF) of these endophytes were screened on dwarf mutant rice (Waito-C) and normal rice (Dongjin-byeo). Endophyte CAC-1A significantly inhibited the growth of Waito-C and Dongjin-byeo. Endophyte CAC-1A was identified as Paraconiothyrium sp. by sequencing the ITS rDNA re...

Journal: :Proceedings of the National Academy of Sciences of the United States of America 1996
C E Fisher J A Sutherland J E Krause J R Murphy S E Leeman J C vanderSpek

We have genetically replaced the native receptor binding domain of diphtheria toxin with an extended form of substance P (SP): SP-glycine (SP-Gly). The resulting fusion protein, DAB389SP-Gly, is composed of the catalytic and transmembrane domains of diphtheria toxin genetically coupled to SP-Gly. Because native SP requires a C-terminal amide moiety to bind with high affinity to the SP receptor,...

2017
Linlin Yang Lei Li

UV radiation triggers the formation of 5-thyminyl-5,6-dihydrothymine, i.e., the spore photoproduct (SP), in the genomic DNA of bacterial endospores. These SPs, if not repaired in time, may lead to genome instability and cell death. SP is mainly repaired by spore photoproduct lyase (SPL) during spore outgrowth via an unprecedented protein-harbored radical transfer pathway that is composed of at ...

Journal: :Biochimica et biophysica acta 2001
D L Tucker K Hirsh H Li B Boardman L A Sherman

The unicellular diazotrophic cyanobacterium, Cyanothece sp. ATCC 51142 temporally separates N2 fixation from photosynthesis. To better understand the processes by which photosynthesis is regulated, we have analyzed Photosystem (PS) II O2 evolution and the PSII lumenal proteins, especially the Mn stabilizing protein (MSP). We describe a procedure using glycine betaine to isolate photosynthetic m...

Journal: :Nucleic acids research 1980
M W Kilpatrick R T Walker

Using in vitro labelling techniques, a tRNAGly from M. mycoides sp. capri PG3 has been shown to have the sequence : pGCAGGUGs4UAGUUUAAUGGCAGAACUUC AGCCUUCCm6AAGCUGAUUGUGAGGGU psi CGAUUCCCUUCACCUGCUCCAOH. The anticodon is UCC and no other tRNAGly has been detected in the crude tRNA isolated from this organism. As is the case with some mitochondrial tRNAs, where the genome size of the organelle i...

نمودار تعداد نتایج جستجو در هر سال

با کلیک روی نمودار نتایج را به سال انتشار فیلتر کنید