Simian virus 40 (SV40) large tumor antigen (T antigen) exists in multiple molecular forms, some of which are separable by zone velocity sedimentation of soluble extracts from infected monkey cells. Three subclasses of this antigen from SV40-infected monkey cells have been separated and characterized: the 5S, 7S, and 14S forms. Newly synthesized T antigen occurs primarily in the 5S form. Chemica...

5,6-dihydroxy-5,6-dihydrothymidine (thymidine glycol) is a major product of the reaction of thymidine with reactive oxygen species, including those generated by ionizing radiation. Thymidine glycol exists as 2 diastereomeric pairs by virtue of the chirality of the C(5) and C(6) atoms. A simple procedure is described for synthesizing and purifying each of the diastereomeric pairs separately. Aft...

A method for the isolation of structural genes, whose transcripts do not contain terminal poly(A) sequences, is presented. Poly(A) tails of predicted length were synthesized at the 3'-OH ends of RNA molecules employing Escherichia coli ATP : RNA adenyltransferase (EC 2.7.7.19). The gene isolation was performed in two steps: (a) enrichment of DNA fragments carrying the genes of interest, (b) sub...

Tandemly repeated ribosomal DNA (rDNA) arrays are among the most evolutionary dynamic loci of eukaryotic genomes. The loci code for essential cellular components, yet exhibit extensive copy number (CN) variation within and between species. CN might be partly determined by the requirement of dosage balance between the 5S and 45S rDNA arrays. The arrays are nonhomologous, physically unlinked in m...

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria.

The organization of the 5S RNA cluster has been analyzed in four strains of Drosophila melanogaster by the Southern technique. In some of the strains the 5S RNA cluster appears to be interrupted by an unrelated sequence. In other strains a continuous cluster is present.

Streptomyces venezuelae ATCC 10595 harbors seven rRNA gene clusters which can be distinguished by BglII digestion. The three rRNA genes present in each set are closely linked with the general structure 16S-23S-5S. We cloned rrnA and sequenced the 16S-23S spacer region and the region downstream of the 5S rRNA gene. No tRNA gene was found in these regions.

A collection of yeast strains surviving with mutant 5S RNA has been constructed. The mutant strains presented alterations of the nucleolar structure, with less granular component, and a delocalization of the 25S rRNA throughout the nucleoplasm. The 5S RNA mutations affected helix I and resulted in decreased amounts of stable 5S RNA and of the ribosomal 60S subunits. The shortage of 60S subunits...

Three contiguous fragments of Escherichia coli 5S rRNA were prepared by T7 transcription from synthetic DNA templates. The central fragment, comprising residues 33-71 of the molecule, was transcribed in the presence of 4-thiouridine triphosphate together with [32P]UTP. The three transcripts were ligated together, yielding a 5S rRNA analogue carrying 4-thiouridine residues at positions 40, 48, 5...