Tandemly repeated ribosomal DNA (rDNA) arrays are among the most evolutionary dynamic loci of eukaryotic genomes. The loci code for essential cellular components, yet exhibit extensive copy number (CN) variation within and between species. CN might be partly determined by the requirement of dosage balance between the 5S and 45S rDNA arrays. The arrays are nonhomologous, physically unlinked in m...

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria.

The organization of the 5S RNA cluster has been analyzed in four strains of Drosophila melanogaster by the Southern technique. In some of the strains the 5S RNA cluster appears to be interrupted by an unrelated sequence. In other strains a continuous cluster is present.

Streptomyces venezuelae ATCC 10595 harbors seven rRNA gene clusters which can be distinguished by BglII digestion. The three rRNA genes present in each set are closely linked with the general structure 16S-23S-5S. We cloned rrnA and sequenced the 16S-23S spacer region and the region downstream of the 5S rRNA gene. No tRNA gene was found in these regions.

A collection of yeast strains surviving with mutant 5S RNA has been constructed. The mutant strains presented alterations of the nucleolar structure, with less granular component, and a delocalization of the 25S rRNA throughout the nucleoplasm. The 5S RNA mutations affected helix I and resulted in decreased amounts of stable 5S RNA and of the ribosomal 60S subunits. The shortage of 60S subunits...

Three contiguous fragments of Escherichia coli 5S rRNA were prepared by T7 transcription from synthetic DNA templates. The central fragment, comprising residues 33-71 of the molecule, was transcribed in the presence of 4-thiouridine triphosphate together with [32P]UTP. The three transcripts were ligated together, yielding a 5S rRNA analogue carrying 4-thiouridine residues at positions 40, 48, 5...

A gene for human 5S rRNA has been cloned and sequenced. The gene was isolated on a 638 bp fragment (Fig. 1) from human placenta DNA by digestion with BamHI and Sad and cloning into a Bluescnpt M13 plasmid. A ^P-labelled SP6-transcript of a mouse pseudogene was used as a probe. The fragment has a restriction pattern identical to the pattern of the majority of human 5S rRNA genes, which are found...

Hypostomus is a diverse group with unclear aspects regarding its biology, including the mechanisms that led to chromosome diversification within the group. Fluorescence in situ hybridization (FISH) with 5S and 18S rDNA probes was performed on ten Hypostomini species. Hypostomus faveolus, H. cochliodon, H. albopunctatus, H. aff. paulinus, and H. topavae had only one chromosome pair with 18S rDNA...

Flax, Linum usitatissimum L., is a valuable multi-purpose plant, and currently, its genome is being extensively investigated. Nevertheless, mapping of genes in flax genome is still remaining a challenging task. The cellulose synthase (CesA) multigene family involving in the process of cellulose synthesis is especially important for metabolism of this fiber crop. For the first time, fluorescent ...