نتایج جستجو برای: pcr polymeras chain reaction

تعداد نتایج: 761221  

2013
G.E. Travería M. Zumarraga I. Etchechoury M.I. Romano A. Cataldi M.F. Alvarado Pinedo I. Pavlik R. Pribylova J.R. Romero

We here identified for the first time the presence of Mycobacterium avium paratuberculosis (MAP) sheep (S) strain in Argentina. IS900 polymerase chain reaction (PCR) was positive. The S strain was compared with MAP cattle (C) strains by using IS1311 PCR-restriction endonuclease analysis (PCR-REA), multiplex PCR and restriction fragment length polymorphism (RFLP) analysis.

Journal: :Animal genetics 2004
K Kinoshita T Shimogiri S Okamoto K Yoshizawa H Mannen H R Ibrahim H H Cheng Y Maeda

DogBAC canine BAC library (http://www.dogmap.ch/) was polymerase chain reaction (PCR)-screened. Primers were designed using canine mRNA sequence GenBank accession no. U62093 (primer UP: GACTGAGTACAAACTGGTGG and primer LO: GGGCCTCACCTCTATGGTG). The PCR conditions were established on canine blood genomic DNA, the corresponding PCR product cloned and verified by sequencing. The positive BAC clone ...

Journal: :Bionatura (Ibarra - Impresa) 2023

This study developed a new multiplex polymerase chain reaction (m-PCR) for rapidly detecting clinically essential strains of V. parahaemolyticus. enables the detection total and potentially virulent strains. The m-PCR was by targeting species-specific transcriptional regulator toxR gene, sequences an outer membrane protein hypothetical encoded omp htp, respectively. htp were discovered original...

2006
M. J. Mauel S. J. Giovannoni J. L. Fryer

A nested polymerase chain reaction (PCR) was developed to detect genomic DNA of Piscirickettsia salmonis, the causative agent of an epizootic disease in salmonids. The nested PCR assay, which used general bacterial 16s rDNA primers in the flrst amplification reaction, and P salmonisspecif~c primers in a second reaction, allowed detection of less than 1 P salmonis tissue culture infect~ous dose ...

Journal: :Nucleic acids research 1991
G. D. Cimino K. C. Metchette J. W. Tessman J. E. Hearst S. T. Isaacs

We describe a photochemical procedure for the sterilization of polynucleotides that are created by the Polymerase Chain Reaction (PCR). The procedure is based upon the blockage of Taq DNA polymerase when it encounters a photochemically modified base in a polynucleotide strand. We have discovered reagents that can be added to a PCR reaction mixture prior to amplification and tolerate the thermal...

Journal: :Japanese Journal of Infectious Diseases 2021

Real-time reverse transcription polymerase chain reaction (RT-PCR) tests for severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) are occasionally repeated when clinicians suspect false-negative results, but the conditions under which RT-PCR testing is warranted remain unclear. We evaluated practice of repeat SARS-CoV-2 in 45 patients who were retested after an initial negative PCR test...

Journal: :Annals of the National Academy of Medical Sciences. India 2023

Abstract Severe acute respiratory syndrome coronavirus 2 causing disease 2019 pandemic is an enveloped virus, showing genome similarity with bat coronavirus. This virus initially infects the upper tract, subsequent spread to lower tract. Despite availability of antigen and antibody detection methods, reverse transcription-polymerase chain reaction (RT-PCR) diagnostic test choice for this novel ...

Journal: :archives of razi institute 2016
b.gh. ghoudarzi a. lotfi a. mesbah a. zare mirakabadi r. bagherian

53 persons suspected to alpha1-antitrypsin deficiency detection (aatd) were investigated for zz, mz, zs, ss, and ms alleles analysis by serum protein electrophoresis (spe), measurement of trypsin inhibiting capacity (tic), isoelectric focusing (ief), polymerase chain reaction (pcr), and ief/pcr-rflp techniques. the result clearly shows by using spe and tic techniques only 35.85 % and 50.08% of ...

2014
J. Abdullah N. Saffie F.A.R. Sjasri A. Husin Z. Abdul-Rahman A. Ismail I. Aziah M. Mohamed

An in-house loop-mediated isothermal amplification (LAMP) reaction was established and evaluated for sensitivity and specificity in detecting the presence of Salmonella Typhi (S. Typhi) isolates from Kelantan, Malaysia. Three sets of primers consisting of two outer and 4 inner were designed based on locus STBHUCCB_38510 of chaperone PapD of S. Typhi genes. The reaction was optimised using genom...

Journal: :Pathogens 2023

Because both Babesia microti and Borrelia burgdorferi can be transmitted by the bite of a single coinfected Ixodes scapularis tick, an attempt was made to determine frequency with which whole blood samples that tested positive for B. infection polymerase chain reaction (PCR) would also test PCR infection. Over 7-year period from 2013 2019, 119 different patients on at least one sample. Among 11...

نمودار تعداد نتایج جستجو در هر سال

با کلیک روی نمودار نتایج را به سال انتشار فیلتر کنید