Environment-dependent genomic features have been defined for different metagenomes, whose genes and their associated processes are related to specific environments. Identification of ORFs and their functional categories are the most common methods for association between functional and environmental features. However, this analysis based on finding ORFs misses noncoding sequences and, therefore...

Myotonic dystrophy type 1 (DM1) is associated with one of the most highly unstable CTG*CAG repeat expansions. The formation of further repeat expansions in transgenic mice carrying expanded CTG*CAG tracts requires the mismatch repair (MMR) proteins MSH2 and MSH3, forming the MutSbeta complex. It has been proposed that binding of MutSbeta to CAG hairpins blocks its ATPase activity compromising h...

1 Caine ED, Shoulson T. Psychiatric syndrome in Huntington's disease. AmJPsychiatry 1983; 140:728-33. 2 Seeman P, Niznik HB, Guan HC, et al. Link between DI and D2 dopamine receptor is reduced in schizophrenia and Huntington's disease brain. Proc Natl Acad Sci USA 1989; 86:10156-60. 3 MacDonald ME, Ambrose CM, Duyao MP, et al. A novel gene containing a trinucleotide repeat that is expanded and ...

Background/aim: Huntington disease (HD) is a progressive adult-onset neurodegenerative disorder presenting an autosomal dominant inheritance. Since there is no information on the prevalence of HD in northwestern Iran, the aim of the present study was to determine the prevalence of HD and the number of CAG trinucleotide repeats in the population of northwestern Iran.Materials and methods: Genomi...

We have developed a simple and sensitive system for detecting AGG trinucleotide repeats through the formation of intermolecular G-quadruplexes using a fluorescent oligonucleotide. The fluorescence signal increased rapidly and dramatically by 44.7-fold with respect to the low background signal in the presence of RNA agg repeats and by 35.0-fold in the presence of DNA AGG repeats.

DNA methylation of CpG dinucleotides is essential for mammalian development, X inactivation, genomic imprinting, and may also be involved in immobilization of transposons and the control of tissue-specific gene expression (Bird & Wolffe, 1999). The common theme in each of these processes is gene silencing. Therefore, gene silencing is a major biological consequence of DNA methylation. As such, ...

associated trinucleotide repeat (NGG)n in Caenorhabditis elegans. Abstract: This work describes the experience with implementation of Streptococcus pyogenes Cas9 nuclease, expressed in C. elegans germline. The described work utilizes guide RNA-unc-22-1000 (GGAGAAGGAGGCGGTGCTGG) designed to target the polyglycine encoding stretch within the unc-22gene embedding the impure trinucleotide (NGG)n PA...