Mutations in homologous recombination (HR) genes BRCA1 and BRCA2 predispose to tumorigenesis. HR-deficient cancers are hypersensitive to Poly (ADP ribose)-polymerase (PARP) inhibitors, but can acquire resistance and relapse. Mechanistic understanding how PARP inhibition induces cytotoxicity in HR-deficient cancer cells is incomplete. Here we find PARP inhibition to compromise replication fork s...

Sustained activation of poly(ADP-ribose) polymerase-1 (PARP-1) and extracellular signal-regulated kinases 1/2 (ERK1/2) both promote neuronal death. Here we identify a direct link between these two cell death pathways. In a rat model of hypoglycemic brain injury, neuronal PARP-1 activation and subsequent neuronal death were blocked by the ERK1/2 inhibitor 2-(2-amino-3-methoxyphenyl)-4H-1-benzopy...

Poly(ADP-ribose) polymerase (PARP) is a nuclear enzyme, which is activated by DNA strand breaks. Although PARP is known to be cleaved by the cysteine protease, caspase-3/CPP32, during apoptosis, signal cascade which regulates the PARP activity has not been fully understood. In this study, we investigated post-translational modification of PARP. We found that PARP was phosphorylated by a serine ...

Poly(ADP-ribose) polymerase-2 (PARP-2) is one of three human PARP enzymes that are potently activated during the cellular DNA damage response (DDR). DDR-PARPs detect DNA strand breaks, leading to a dramatic increase in their catalytic production of the posttranslational modification poly(ADP-ribose) (PAR) to facilitate repair. There are limited biochemical and structural insights into the funct...

The interaction between poly(ADP-ribose) polymerase (PARP) and the product of the tumor suppressor gene p53 has been described previously. Here, we have investigated whether PARP deficiency may affect the expression and regulation of wild-type (wt) p53. For this purpose, we have used immortalized cells derived from wt and PARP knockout mice. We have found a clearly reduced basal level of PAb421...

Poly(ADP-ribose) polymerase-1 (PARP-1) is a member of the PARP enzyme family consisting of PARP-1 and several recently identified novel poly(ADP-ribosylating) enzymes. PARP-1 is an abundant nuclear protein functioning as a DNA nick-sensor enzyme. Upon binding to DNA breaks, activated PARP cleaves NAD(+) into nicotinamide and ADP-ribose and polymerizes the latter onto nuclear acceptor proteins i...

A double-stranded 9 bp GTGAAAAAG pJ alpha sequence found in human centromeric alpha-satellite DNA and a 28 bp ATGTATATATGTGTATATAGACATAAAT tandemly repeated AT28 sequence found within a cloned neo- centromere DNA have each allowed the affinity purification of a nuclear protein that we have identified as poly(ADP-ribose) polymerase (PARP). Use of other related or unrelated oligonucleotide sequen...

The damage to DNA caused by ultraviolet B radiation (280-320 nm) contributes significantly to development of sunlight-induced skin cancers. The susceptibility of mice to ultraviolet B-induced skin carcinogenesis is increased by an inhibitor of the DNA damage-activated nuclear enzyme poly(ADP-ribose) polymerase-1 (PARP), hence PARP activation is likely to be associated with cellular responses th...

PARP-1 is a nuclear protein that has important roles in maintenance of genomic integrity. During genotoxic stress, PARP-1 recruits to sites of DNA damage where PARP-1 domain architecture initiates catalytic activation and subsequent poly(ADP-ribose)-dependent DNA repair. PARP-1 inhibition is a promising new way to selectively target cancers harboring DNA repair deficiencies. However, current in...

Increased generation of reactive oxygen species (ROS) and the subsequent DNA damage and excessive activation of poly(ADP-ribose) polymerase-1 (PARP-1) have been implicated in the pathogenesis of ischemic injury. We previously demonstrated that pharmacological inhibition of PARP protects against ischemic renal injury (IRI) in rats (Martin DR, Lewington AJ, Hammerman MR, and Padanilam BJ. Am J Ph...