In induction of systemic and mucosal immunity, particulate antigens are more effective than soluble antigens possibly because they are more efficiently endocytosed by mucosal-associated lymphoid tissue (MALT) M cells. In this study, we determined the systemic and mucosal immune responses in rabbits following intranasal immunization of tetanus toxoid TT and CpG-ODN encapsulated within PLGA nanos...

In induction of systemic and mucosal immunity, particulate antigens are more effective than soluble antigens possibly because they are more efficiently endocytosed by mucosal-associated lymphoid tissue (MALT) M cells. In this study, we determined the systemic and mucosal immune responses in rabbits following intranasal immunization of tetanus toxoid TT and CpG-ODN encapsulated within PLGA nanos...

Although dendritic cells (DC) have been well demonstrated as a strong cellular adjuvant for a tumor vaccine, there are several limitations for clinical application. A protein-based vaccine using a potent adjuvant is an appealing approach for tumor antigen-specific immunotherapy because of their simplicity, safety, efficacy and capacity for repeated administration. CpG-oligodeoxynucleotides (ODN...

Early vaccination is necessary to protect infants from various infectious diseases. However, this is often unsuccessful largely due to the immaturity of the neonatal immune system. Furthermore, maternally derived antibodies can interfere with active immunization. We have previously shown in young mice that immune responses against several different antigens can be improved by the addition of ol...

Synthetic oligodeoxynucleotides (ODN) consisting of unmethylated bacterial DNA sequences with CpG motifs are potent immunological adjuvants. Immunostimulatory CpG sequences are species-specific. Optimal CpG sequences specific for humans, rodents, livestock, and companion animals have been reported. Nearly all of these reports describe the use of soluble forms of CpG ODN and antigens. We investi...

Cholera toxin (CT) is the most potent known mucosal adjuvant, but its toxicity precludes its use in humans. Here, in an attempt to develop safe and effective mucosal adjuvants, we compared immune responses to simian immunodeficiency virus (SIV) virus-like particles (VLPs) after intranasal coimmunization with RANTES, CpG oligodeoxynucleotides (ODN), or CT. Antibody analysis demonstrated that RAN...

Inhibitory oligodeoxynucleotides (ODNs), which are capable of blocking CpG-induced inflammation, have been anticipated to be beneficial therapeutic agents for autoimmune diseases. In this study, we show that GpC ODN, which inverted the cytosine guanine sequence of CpG motif to guanine cytosine sequence, is an inhibitory ODN. The inhibitory effects of GpC ODN on CpG ODN-induced immune activation...

Oligodeoxynucleotides (ODN) containing unmethylated CpG dinucleotides induce proliferation of B cells and activation of macrophages and thus stimulation of the immune system. We tested an oligonucleotide containing an unmethylated CpG dinucleotide flanked by two 5' purines and two 3' pyrimidines (GAGAACGCTCGACCTTCGAT) for the ability to affect antibody levels to tetanus toxoid (Tt). Groups of m...

BACKGROUND Toll-like receptors (TLRs) have been shown to be involved in cerebral ischemia/reperfusion (I/R) injury. TLR9 is located in intracellular compartments and recognizes CpG-DNA. This study examined the effect of CpG-ODN on cerebral I/R injury. METHODS AND RESULTS C57BL/6 mice were treated with CpG-ODN by i.p. injection 1 hour before the mice were subjected to cerebral ischemia (60 min...

Mitochondrial transcription factor A (TFAM) had previously been shown to act as a damage associated molecular pattern with the ability to enhance CpG-A phosphorothioate oligodeoxynucleotide (ODN)-mediated stimulation of IFNα production from human plasmacytoid dendritic cells. Examination of the mechanism by which TFAM might influence CpG ODN mediated innate immune responses revealed that TFAM b...