Studies on the value of culture-independent molecular identification of bacteria in cardiac valves are mostly restricted to comparing agreement of identification to what is obtained by culture to the number of identified bacteria in culture-negative cases. However, evaluation of the usefulness of direct molecular identification should also address weaknesses, their relevance in the given settin...

b a ckground: zoonotic cutaneous leishmaniasis (zcl) is endemic in many parts of iran. recently its incidence isconsiderable in different parts of jahrom district, in fars province, southern iran. the aims of our study were to in- vestigate the prevalence of leishmania infection, and identify and characterize the   leishmania species present, among the rodents by molecular methods in a new ende...

Cynara scolymus L., known as globe artichoke, is a medicinal plant widely used in food supplements (PFS) and herbal infusions due to its beneficial health properties. The high demand for artichoke-containing products can lead adulteration practices. In this work, real-time polymerase chain reaction (PCR) system coupled high-resolution melting (HRM) analysis was proposed differentiate C. from ot...

Structural alterations of the apolipoprotein E (apo E) are known to influence the lipid metabolism. The three most common isoproteins Arg 158) are encoded by three co-dominant alleles (e2, el, e4). Phenotyping is cumbersome and, therefore, several methods for apo E genotyping have been developed. Of these, PCR-RFLP (restriction fragment length polymorphism) is currently most rapid and cost-effe...

Polymerase chain reaction (PCR) as a method for preparing DNA templates has been used for several DNA sequencing applications. An in situ procedure for directly sequencing PCR products by the dideoxy-termination method has been developed by using fluorophore-labeled sequencing primers. Completed sequence reactions were combined and loaded into a single electrophoretic lane of a fluorescence-bas...

PCR permits the exponential and sequence-specific amplification of DNA, even from minute starting quantities. PCR is a fundamental step in preparing DNA samples for high-throughput sequencing. However, there are errors associated with PCR-mediated amplification. Here we examine the effects of four important sources of error-bias, stochasticity, template switches and polymerase errors-on sequenc...

BACKGROUND The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform) has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR) reactions and subsequent sequencing runs have been unable to combine template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to th...

Analyzing EGFR mutations and detecting ALK gene fusion are indispensable when planning to treat pulmonary adenocarcinoma. Malignant pleural effusion (MPE) is a devastating complication of lung cancer and sometimes the only source for mutation analysis. The percentage of tumor cells in the pleural effusion may be low; therefore, mutant enrichment is required for a successful analysis. The EGFR m...

ABSTRACT: Leishmania infantum causes canine leishmaniasis. Using parasitological and molecular analyses, we identified L. in the reproductive organs of male female dogs. histochemistry, immunohistochemistry, PCR, examined tissue samples from 8 dogs 16 diagnosed with Despite absence macroscopic or microscopic lesions these organs, observed amastigotes testis uterus. PCR sequencing tissues reveal...

DogBAC canine BAC library (http://www.dogmap.ch/) was polymerase chain reaction (PCR)-screened. Primers were designed using canine mRNA sequence GenBank accession no. U62093 (primer UP: GACTGAGTACAAACTGGTGG and primer LO: GGGCCTCACCTCTATGGTG). The PCR conditions were established on canine blood genomic DNA, the corresponding PCR product cloned and verified by sequencing. The positive BAC clone ...