in the present study, interactions between lead exposure with nitric oxide precursor (l-arginine) or nitric oxide synthase (nos) inhibitor (l-name) on naloxone-induced jumping and diarrhea in morphine-dependent mice were examined. chronic lead acetate (0.05%) exposure altered naloxone-induced jumping and diarrhea in mice. jumping was decreased after 7 days and was unchanged 14 and 28 days after...

This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, l-leucine; R, l-arginine) (MC-LR) containing 5? thiolated 60-mer DNA aptamer (i.e., 5?-SH-(CH2)6GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCT CCGC-3?). A nanocomposite electrode platform comprising biocompatible poly(2,5-dimethoxyaniline) (PDMA)-poly(vinylsulfonate) (PVS) and silver nanoparticle...

Nano-sized materials present new opportunities in biology and medicine and they are used as biomedical tools for investigation, separation of molecules and cells. To achieve more effective cancer therapy, it is essential to select cancer cells exactly. This research suggests that using the antibody-functionalized nontoxic Arginine-doped magnetic nanoparticles (A-MNPs), has been prosperous in de...

Background: The assessment of altered nitric oxide (NO) availability is of potentially important diagnostic and prognostic significance. The present study is aimed to investigate the effect of L-arginine (as a natural NO donor) supplementation on NO metabolite in a rabbit model of hypercholesterolemia to find a reliable marker for endothelial NO production. Methods: White male rabbits (n = 30)...

results the maximum si was obtained at the highest applied flip angle (45°). the linear relationship between si and nanoparticle concentration was seen up to 112.21 and 98.83 μmol fe/l for the short (10°) and the long (45°) flip angles, respectively (r2 = 0.95). these values were reduced up to 48.54 and 42.73 μmol fe/l for these flip angles with r2 of 0.99. conclusions the maximum si will be in...

In the present study, interactions between lead exposure with nitric oxide precursor (L-arginine) or nitric oxide synthase (NOS) inhibitor (L-NAME) on naloxone-induced jumping and diarrhea in morphine-dependent mice were examined. Chronic lead acetate (0.05%) exposure altered naloxone-induced jumping and diarrhea in mice. Jumping was decreased after 7 days and was unchanged 14 and 28 days after...

Objective(s) The process of wound healing involves tightly integrated events including inflammation, granulation tissue formation and remodeling. Systemic administration of L-arginine promotes wound healing but its global side effects are undesirable. To confine the action of L-arginine at the site of injury, we tested the effects of local administration of L-arginine on the healing of excisio...

Nucleus accumbens (Nac) has been considered as a center for the induction of drug dependence. Since a high concentration of the enzyme, nitric oxide synthase (NOS) has been found in the Nac, and this fact that the role of nitric oxide (NO) in acquisition and expression of drug dependence has become clear in recent years, therefore in this study the effects of intraaccumbal injections of L-argin...

The aim of this study was to test the effect of two different morphologies of silver nanoparticles, spheres, and prisms, on their antibacterial properties when coated with poly-L-arginine (poly-Arg) to enhance the interactions with cells. Silver nanoparticle solutions were characterized by UV-visible spectroscopy, transmission electron microscopy, dynamic light scattering, zeta potential, as we...