نتایج جستجو برای: oligonucleotide
تعداد نتایج: 27990 فیلتر نتایج به سال:
Here we describe a process for the generation of oligonucleotide libraries representative of a given nucleic acid. Starting from at random pool of DNA oligonucleotides, the technique selects only those that hybridize to the nucleic acid template. This selection yields a highly specific library that represents an oligonucleotide image of the chosen template. The novel quality of this approach is...
An antisense phosphorothioate (S)-oligonucleotide to a sequence in the intervening (I) region of the gamma 2b immunoglobulin (Ig) heavy chain gene inhibits Ig secretion by B cells stimulated with lipopolysaccharide (LPS) or LPS plus interleukin 4. It is also a striking stimulant of DNA synthesis by resting B cells. The antisense S-oligonucleotide causes a 10-20-fold increase in the expression o...
The polymerase chain reaction (PCR) is most effectively performed using a thermostable DNA polymerase such as that isolated from Thermus aquaticus. Since temperature and oligonucleotide length are known to control the specificity of oligonucleotide hybridization, we have investigated the effect of oligonucleotide length, base composition, and the annealing temperature on the specificity and eff...
The gapped duplex DNA approach to oligonucleotide-directed construction of mutations (Kramer et al. 1984, Nucl. Acids Res. 12, 9441-9456) has been developed further. A procedure is described that makes in vitro DNA polymerase/DNA ligase reactions dispensable. Direct transfection of host bacteria with gdDNA molecules of recombinant phage M13 plus mutagenic oligonucleotide results in marker yield...
in this study, the bacterial diversity in the activated sludge system of a full-scale municipalwastewater treatment plant in dubai was monitored over a period of one year using ribosomal rna (rrna)targeted oligonucleotide probes for a defined phylogenetic group of bacteria by the fluorescence in situhybridization (fish) technique. the largest fraction of the bacterial community in the sludge sa...
In this study, we present a portable and generic DNA bioassay system based on in situ oligonucleotide synthesis followed by hybridization based detection. The system include two main parts, an oligonucleotide synthesizer and a fluorescence detection system. The oligonucleotide synthesizer is based on microfluidic technology and capable of synthesizing any desired oligonucleotide which can be ei...
New Methods for the Characterization of Different Gelatin Based Nanoparticulate Drug Carrier Systems
Peak 1 displays the adaptation of the fractionation conditions as described above to the siRNA oligonucleotide. With an increased initial cross-flow intensity the separation from the void peak, inherent to AF4 systems, will be enhanced (peak 2). The higher MW of the siRNA oligonucleotide compared to the ssDNA oligonucleotide permit the application of a 5 kDa cut-off ultrafiltration membrane Sim...
Oligonucleotides find several numbers of applications: as diagnostic probes, RT and PCR primers and antisense agents due to their ability of forming specific interactions with complementary nucleotide sequences within nucleic acids. These interactions are strongly affected by accessibility of the target sequence in the RNA structure. In the present work the mechanism of invasion of RNA structur...
MATERIALS 10x Amplification buffer Include 0.01% (w/v) gelatin in the buffer. 10x Bacteriophage T4 DNA ligase buffer Bacteriophage T4 DNA ligase Ethanol Optional, please see Step 5. Oligonucleotide (linker) primer (5.0 OD260/ml [approx. 17 μM]) in TE (pH 7.6) 5'CATGCTCGGTCGGGATAGGCACTGGTCTAGAG3' This oligonucleotide is identical in sequence to the 32 nucleotides at the 5' end of the oligonucleo...
PURPOSE The efficacy of sterically stabilized liposomes for delivering a model phosphodiester oligonucleotide intravitreally was investigated in the rabbit. METHODS Ocular distribution and clearance from the vitreous humor of a model 16-mer oligothymidylate (pdT16) were evaluated in the rabbit by radioactivity measurements after intravitreal injection of either a solution or liposomes contain...
نمودار تعداد نتایج جستجو در هر سال
با کلیک روی نمودار نتایج را به سال انتشار فیلتر کنید