نتایج جستجو برای: pcr sequencing
تعداد نتایج: 283892 فیلتر نتایج به سال:
We propose a genome sequencing strategy, which is neither divide-and-conquer (clone by clone) nor the shotgun approach. Random PCR-based and PCR relay sequencing constitute the basis of this novel strategy. Most of the genome is sequenced by the former process that requires only a set of non-specific primers and a template DNA. Random PCR-based sequencing reduces redundancy in sequencing by exp...
We describe a method for direct cycle sequencing of PCR fragments amplified from genomic DNA or cDNA. DNA sequencing template is amplified using PCR and oligonucleotide primers flanking the region of interest. The amplified fragment is directly cycle sequenced using fluorescent sequencing primers, Sanger dideoxy sequencing chemistry and an enzyme mixture of a mutant Taq DNA polymerase and therm...
Purpose: The aim of this study was cloning the Gba enzyme in pUCBM21 plasmid, and making frame mutation on it and sequencing it. Materials and methods: mRNA was extracted from mouse spleen and glucocerebrosidase cDNA was synthesized and amplified by PCR with specific primers. cDNA was cloned in pUCBM21 and analyzed by restriction enzymes. A fragment of its sequence was deleted using MscI restr...
Abstract Background The generation of accurate and reproducible viral sequence data is necessary to understand the diversity present in populations RNA viruses isolated from clinical samples. While various sequencing methods are available, they often require high quality templates titer ensure reliable data. Methods We modified a multiplex PCR approach characterize simian immunodeficiency virus...
Mucormycosis is difficult to diagnose. Samples from suspected cases often fail to grow Mucorales in microbiologic cultures. We identified all hematologic malignancy and stem cell transplant patients diagnosed with proven mucormycosis between 2001 and 2009 at Brigham and Women's Hospital/Dana-Farber Cancer Institute. Seminested PCR targeting Mucorales 18S ribosomal DNA and sequencing were perfor...
DogBAC canine BAC library (http://www.dogmap.ch/) was polymerase chain reaction (PCR)-screened. Primers were designed using canine mRNA sequence GenBank accession no. U62093 (primer UP: GACTGAGTACAAACTGGTGG and primer LO: GGGCCTCACCTCTATGGTG). The PCR conditions were established on canine blood genomic DNA, the corresponding PCR product cloned and verified by sequencing. The positive BAC clone ...
کازئین ها پروتئین های شیر هستند که توسط سلول های پستان تولید می شوند و 78 تا 82 درصد از پروتئین های شیر گاو را تشکیل می دهند. ژن های کازئین ها به یکدیگر متصل هستند و با هم به ارث می رسند و در حال حاضر به عنوان مارکر مولکولی به منظور marker assisted selection برای بهبود خواص شیر استفاده می شوند. کاپاکازئین یکی از مهم ترین کازئین ها است که نقش بسیار مهمی در شکل دهی، پایداری و تجمع میسل های کازئین...
نمودار تعداد نتایج جستجو در هر سال
با کلیک روی نمودار نتایج را به سال انتشار فیلتر کنید