A newborn infant with phenotypic features of trisomy for distal 13q was found to have recombinant inversion duplication involving the (13)(q22-->qter) region. Parental karyotypes showed that the mother had a normal 46,XX complement and the father had an apparently balanced pericentric inversion of a chromosome 13. Because of the unusual nature of the inversion, the exact position of the centrom...

A double-stranded 9 bp GTGAAAAAG pJ alpha sequence found in human centromeric alpha-satellite DNA and a 28 bp ATGTATATATGTGTATATAGACATAAAT tandemly repeated AT28 sequence found within a cloned neo- centromere DNA have each allowed the affinity purification of a nuclear protein that we have identified as poly(ADP-ribose) polymerase (PARP). Use of other related or unrelated oligonucleotide sequen...

Construction of a mammalian artificial chromosome (MAC) will develop our understanding of the requirements for normal chromosome maintenance, replication and segregation while offering the capacity for introducing genes into cells. Construction of MACs with telomere, centromere and replication function has been approached by two methods. The 'top down' strategy uses artificially induced chromos...

Histone methylation performs multiple functions such as DNA replication, transcription regulation, heterochromatin formation, and chromatin condensation. How this methylation gradient is orchestrated in the centromere during chromosome segregation is not known. Here we examine the temporal dynamics of protein methylation in the centromere by SUV39H1 methyltransferase, a key mitotic regulator, u...

The definition of centromeres of human chromosomes requires a complete genomic understanding of these regions. Toward this end, we report integration of physical mapping, genetic, and functional approaches, together with sequencing of selected regions, to define the centromere of the human X chromosome and to explore the evolution of sequences responsible for chromosome segregation. The transit...

Previous work has identified sequences specific to the B chromosome that are a major component of the B centromere. To address the issue of the origin of the B and the evolution of centromere-localized sequences, DNA prepared from plants without B chromosomes was probed to seek evidence for related sequences. Clones were isolated from maize line B73 without B chromosomes by screening DNA at red...

Mitotic centromere-associated kinesin (MCAK) is recruited to the centromere at prophase and remains centromere associated until after telophase. MCAK is a homodimer that is encoded by a single gene and has no associated subunits. A motorless version of MCAK that binds centromeres but not microtubules disrupts chromosome segregation during anaphase. Antisense-induced depletion of MCAK results in...

During meiotic prophase, telomeres cluster, forming the bouquet chromosome arrangement, and facilitate homologous chromosome pairing. In fission yeast, bouquet formation requires switching of telomere and centromere positions. Centromeres are located at the spindle pole body (SPB) during mitotic interphase, and upon entering meiosis, telomeres cluster at the SPB, followed by centromere detachme...

During cell division, multiple processes are highly coordinated to faithfully generate genetically equivalent daughter cells. In bacteria, the mechanisms that underlie the coordination of chromosome replication and segregation are poorly understood. Here, we report that the conserved replication initiator, DnaA, can mediate chromosome segregation independent of replication initiation. It does s...

We present a case with a small extra ring chromosome which was found in 66% of lymphocytes on routine cytogenetic examination. FISH analyses, using centromere specific and single copy probes, showed that the extra ring chromosome was derived from the most proximal part of 10p, close to the centromere. The patient has a unilateral cleft lip and palate, mild dysmorphic features, and mild mental r...