UNLABELLED G-PRIMER, a web-based primer design program, has been developed to compute a minimal primer set specifically annealed to all the open reading frames in a given microbial genome. This program has been successfully used in the microarray experiment for analyzing the expression of genes in the Xanthomonas campestris genome. AVAILABILITY It is available at http://mammoth.bii.a-star.edu...

Tetra-primer ARMS-PCR is used extensively as a low cost, single PCR assay requiring no post-PCR manipulation. The design of successful primers depends on a number of variables such as melting temperatures, GC content, complementarity and selection of mismatch bases. The optimal selection of primers can be achieved in an automated way using a program which evaluates candidate primers for a given...

UNLABELLED We developed a CGI/Perl-based web server to perform in silico polymerase chain reaction (PCR) on PCR primer sequences. The PUNS (Primer-UniGene Selectivity) server simulates PCR reactions by running BLASTN analysis on user-entered primer pairs against both the transcriptome and the genome to assess primer specificity. PUNS is particularly suited for the identification of highly selec...

Polymorphism. Two alleles of a DNA region (HFABPL) with high homology to the bovine heart-fatty acid binding protein (H-FABP) cDNA were detected through RFLP analysis of PCR products digested with the restriction enzyme RsaI. Primer Source. Primers were designed based on the bovine cDNA sequence for H-FABP (Billich et al., 1988) to amplify between nucleotides 66-676. The primer s quences were ...

Correction We have previously demonstrated the expression of inhibin subunits in endometrial tissues and used b-actin primer pairs to perform a PCR analysis loading control [1]. However, instead of using the mentioned b-actin primer pairs from a commercial molecular biology supplier, we used the b-actin primer pair listed in Table 1. All depicted primer pairs in Table 1 were designed and establ...

Technical Appendix Table. PCR primer pairs used to recover whole-genome sequences of gemycircularviruses Primer pair Forward primer sequence 5′3′ Reverse primer sequence 5′3′ HV-GcV1–1 TTATATGCCCAGACGGACCC ATTGTGCGGCGGATAGGATA HV-GcV1–2 CGAATTTAACCCCGGATGCA AAGGATGCCACCCGAATGTA HV-GcV1–3 TTGTTCGATCAGACCACCGA GTTCCTTCCGAGCTACAAGT HV-GcV1–4 TCGATGTTAACTCCCTCCGG GAAACGTGTAGATCGGCGAC HV-GcV2–1 TT...

Herein we investigated the effect of primer binding site polymorphisms in achieving correct genotyping when a mismatch occurs in distinct positions of the primer sequence. For that purpose primer sequences were designed in order to carry either allelic form at the 3’ end and at 3 bp, 5 bp and 7 bp apart from the 3’end of an intronic polymorphism (rs2247836) observed in phenylalanine hydroxylase...

Klebsiella granulomatis is gram-negative bacteria of the genus Klebsiella which causes sexually transmitted disease (STD) Donovanosis and urinary tract infection in older persons. In the present work, in silico approach for primer designing has been implemented; to gather more information about the bacterium. Primer plays an important role to initiate the process of Polymerase Chain Reaction (P...

DNA sequencing can be performed much faster and more easily by an automated DNA sequencer, which can process a large quantity of samples at one time. We use an Applied Biosystems DNA sequencer, Model 373A. Among several methods applicable to the sequencer, the dye-primer method of singlestranded template with Taq DNA polymerase gives the most reliable results. If both dye-primers (forward dye-p...