The nucleotide sequences of two tRNAAsngenes from tobacco chloroplasts

نویسندگان
چکیده

برای دانلود رایگان متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

The Nudeotide Sequences of Two Trna Genes from Tobacco Chloroplasts

Recombinant plasmids which contain EcoRI fragments of tobacco chloroplast DNA carrying tRNA genes were constructed. Plasmids pTC211 and pTC293 contain the base sequences for tRNA in their 1.4 and 1.1 Md EcoRI fragments, respectively. These two tRNA sequences are identical and are; 5'-TCCTCAGTAGCT CAGTGGTAGAGCGGTCGGCTGTTAACCGATTGGTCGTAGGTTCGAATCCTACTTGGGGAG-3. Each tRNA gene is located at about ...

متن کامل

The nucleotide sequence of 4.5S ribosomal RNA from tobacco chloroplasts.

The nucleotide sequence of tobacco chloroplast 4.5S ribosomal RNA has been determined to be: OHG-A-A-G-G-U-C-A-C-G-G-C-G-A-G-A-C-G-A-G-C-C-G-U-U-U-A-U-C-A-U-U-A-C-G-A-U-A-G-G-U-G-U-C-A-A-G-U-G-G-A-A-G-U-G-C-A-G-U-G-A-U-G-U-A-U-G-C-(G-A)-C-U-G-A-G-G-C-A-U-C-C-U-A-A-C-A-G-A-C-C-G-G-U-A-G-A-C-U-U-G-A-A-COH. The 4.5S RNA is 103 nucleotides long and its 5'-terminus is not phosphorylated.

متن کامل

The nucleotide sequences of the initiator transfer RNAs from bean cytoplasm and chloroplasts.

The initiator tRNAsMet from the cytoplasm and chloroplasts of Phaseolus vulgaris have been purified and sequenced. The sequence of bean cytoplasmic initiator tRNAiMet is : pA-U-C-A-G-A-G-U-m1G-m2G-C-G-C-A-G-C-G-G-A-A-G-C-G-U-m2G-G-U-G-G-G2-C-C-C-A-U-t6A-A-C-C-C-A-C-A-G-m7G-D-m5C-C-C-A-G-G-A-psi-C-G-m1A-A-A-C-C-U-Gm-G-C-U-C-U-G-A-U-A-C-C-AOH. The sequence of bean cytoplasmic tRNAiMet is almost i...

متن کامل

the effect of traffic density on the accident externality from driving the case study of tehran

در این پژوهش به بررسی اثر افزایش ترافیک بر روی تعداد تصادفات پرداخته شده است. به این منظور 30 تقاطع در شهر تهران بطور تصادفی انتخاب گردید و تعداد تصادفات ماهیانه در این تقاطعات در طول سالهای 89-90 از سازمان کنترل ترافیک شهر تهران استخراج گردید و با استفاده از مدل داده های تابلویی و نرم افزار eviews مدل خطی و درجه دوم تخمین زده شد و در نهایت این نتیجه حاصل شد که تقاطعات پر ترافیک تر تعداد تصادفا...

15 صفحه اول

a case study of the two translators of the holy quran: tahereh saffarzadeh and laleh bakhtiar

بطورکلی، کتاب های مقدسی همچون قران کریم را خوانندگان میتوان مطابق با پیش زمینه های مختلفی که درند درک کنند. محقق تلاش کرده نقش پیش زمینه اجتماعی-فرهنگی را روی ایدئولوژی های مترجمین زن و در نتیجه تاثیراتش را روی خواندن و ترجمه آیات قرآن کریم بررسی کند و ببیند که آیا تفاوت های واژگانی عمده ای میان این مترجمین وجود دارد یا نه. به این منظور، ترجمه 24 آیه از آیات قرآن کریم مورد بررسی مقایسه ای قرار ...

15 صفحه اول

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

ژورنال

عنوان ژورنال: Nucleic Acids Research

سال: 1981

ISSN: 0305-1048,1362-4962

DOI: 10.1093/nar/9.21.5601