Vectors for inducible expression of dual epitope-tagged proteins in insect cells.

Expression and purification of recombinant proteins are fundamental techniques in molecular biology. Many different cell systems ranging from bacteria to mammalian cell lines are commonly used. One of the most widely used systems is the baculovirus expression system. An alternative for large-scale production of eukaryotic proteins are stably transfected Schneider Drosophila line 2 cells (Catalog No. CRL-1963; ATCC, Rockville, MD, USA), abbreviated SL2 or S2, derived from Drosophila melanogaster embryos (13). The generation of stable transfectants of insect cells (2) is fast, and it circumvents amplification, titration and storage of virus stocks. In addition, tightly regulated promoters, such as the metallothionein (MET) promoter (4), are available to control production of the recombinant protein. Surveillance and purification of an expressed protein can be simplified by epitope-tagging. Widely used epitopes are the hemagglutinin (HA) (14) and the FLAG epitopes (Scientific Imaging Systems [Eastman Kodak], New Haven, CT, USA) (10), which consist of nine (YPYDVPDYA) and eight (DYKDDDDK) amino acid peptides, respectively. Both epitopes can easily be detected by commercially available antibodies. The FLAG epitope also contains the recognition sequence for the protease enterokinase and thus, if necessary, can be removed. Here, we describe transfer vectors designed for the regulated expression of dual epitope-tagged proteins in SL2 cells. The recombinant proteins contain both the HA and the FLAG epitope at their N terminus. Thus, either antibodies to HA and/or FLAG can be used for detection and purification. The presence of two epitopes could be of particular advantage if antibodies to one of the epitopes cross-react with cellular proteins. In addition, SL2 cell lines were established that express the epitope-tagged transcription factors Sp1, Sp3, a mutant of Sp3 and HNF3α. To generate the HA/FLAG expression vectors, a pair of phosphorylated complementary oligonucleotides, 5′AATTGGATCCTGAACCACCATGGGATACCCTTATGATGTTCCTGATTATGCCTCCGACTACAAAGACGATGACGATAAAAG-3′ and 5′-AATTCTTTTATCGTCATCGTCTTTGTAGTCGGAGGCATAATCAGGAACATCATAAGGGTATCCCATGGTGGTTCAGGATCC-3′, was synthesized, annealed and cloned into the EcoRI site of the plasmid pRmHa-3, which is a derivative of the plasmid pRmHa-1 (4). The plasmid pRmHa-3 contains the copper-inducible MET promoter, a multiple cloning site (MCS) and the polyadenylation signal of the Drosophila melanogaster alcohol dehydrogenase (ADH) gene. pRmHa-3 is identical to pRmHa-1 with the exception that it contains three additional single cloning sites. The 5′ end of the annealed double-stranded oligonucleotide was designed such that the EcoRI site was destroyed after cloning (GAATTG), whereas the 3′ EcoRI site remained intact (GAATTC). Plasmids containing the correct insert orientation were identified by restriction analyses and sequencing. The resulting plasmid (pMET-HA/FLAG) contains, downstream of the MET promoter, a consensus Kozak sequence (12) flanking the AUG start codon and the codons for the HA and FLAG epitopes followed by a MCS (Figure 1A). To test the vector, four open reading frames encoding the transcription factors Sp1 (11), Sp3 (8), a mutant of Sp3 (Sp3SD) (6) lacking the inhibitory domain and HNF3α (5) were subcloned into the MCS of pMET-HA/FLAG (Figure 1B). The resulting plasmids pMET-HA/FLAG-Sp1, pMET-HA/ FLAG-Sp3, pMET-HA/FLAG-Sp3SD and pMET-HA/FLAG-HNF3α were analyzed in transient transfection experiments using appropriate reporter constructs (3,9). These experiments show that the epitopes do not interfere with the activation properties of the transcription factors (data not shown). To generate stable transfectants of SL2 cells, the recombinant transfer vectors were transfected into SL2 cells along with the plasmid pLTR-Hygro (2) at a 19:1 molar ratio using the calcium-phosphate method (7). The plasmid pLTR-Hygro contains the hygromycinBenchmarks