Inactivating the f32-microglobulin locus in mouse

We have inactivated, by gene targeting, the endogenous (2-microglobulin gene in a mouse embryonic stem cell line. A cloned fragment of the fi2-microglobulin gene with the coding sequence disrupted by the insertion of the neomycinresistance gene was used to transfect the embryonic stem cells. G418-resistant colonies were selected and then screened using the polymerase chain reaction to identify those in which the incoming DNA had integrated into the embryonic stem cell genome by homologous recombination. Of a total of 234 G418-resistant colonies screened, 2 correctly targeted colonies were identified. Chimeric mice carrying the inactivated P2microglobulin gene have been obtained from both of these targeted embryonic cell lines. Breeding of offspring from such animals will allow investigation of the effects of homozygous loss of (P2-microglobulin. P32-Microglobulin (/32m) is a 99-amino acid polypeptide necessary for the assembly and expression at the cell surface of the many varieties of histocompatibility class I proteins, including the highly polymorphic H2-K and H2-L/D proteins. These proteins form complexes with viral, tumor, and normal self antigens and display them to potentially responsive cells (1, 2). Although the role of this presentation for inducing and suppressing immune responses has been well documented, its importance to the integrity of the complete organism is not well understood. In addition, the complex patterns of expression of various members of the class I family have led to suggestions that they serve as differentiation antigens critical for normal development, particularly but perhaps not solely of cells in the immune system. f32m is also required for expression of the products of the Qa/Tla genes at the cell surface. These genes have a high level of sequence homology with the classical class I antigens, but they differ from them in not being polymorphic. It has not been possible to assign a function to any of the Qa/Tla antigens. Low levels of H2-K and H2-D/L expression are first detected during the midsomite stage ofembryogenesis (day 9) when embryos have developed beyond primordial organogenesis and blood circulation has commenced. The level of transcription of these genes remains low until day 13 of gestation (3). Although class I antigens continue to be detectable on virtually all somatic cells, the level of their expression can vary 100-fold. A dramatic variation in expression occurs during maturation ofT cells, suggesting that class I antigens play a role in this process. Although the classical class I antigens do not seem to be expressed until the midsomite stage of embryogenesis, /2m has been detected in twoto eight-cell embryos (4). This ,32m may be associated with the products of the Qa/TI region, since the Qa-2 antigen has been detected in the two-cell to blastocyst stage of mouse embryos (5). The ability to create specific genetic mutations in embryonic stem cells (ES cells) (6) using homologous recombination (7, 8) and to transfer these mutations to the germ line (9, 10) provides an approach to many developmental questions. As a first step toward better understanding the function of P2m-associated antigens during development, we have disrupted the ,2m gene in a mouse ES cell line using homologous recombination. Two independent targeted ES cell lines containing the disrupted f32m gene were identified using the polymerase chain reaction (PCR) to screen for homologous recombination events (11, 12). Chimeric mice have been produced with both of these lines. MATERIALS AND METHODS Construction of the Targeting Plasmid. Plasmid pKCP2B contains the entire ,32m gene within an 8.4-kilobase-pair (kbp) Xho I fragment (13, 14). The 5' Xho I-BamHI fragment of this gene was subcloned into pUC19. Two Kpn I restriction enzyme sites, one in the 5' flankingDNA and the other within the first intron, were removed by digestion with Kpn I followed by treatment with T4 polymerase and religation. A unique Cla I site was created in exon 2 by partial digestion with EcoRI followed by treatment with the Klenow fragment of DNA polymerase I and ligation with Cla I linkers. The 1150-bpXho I-BamHI fragment ofthe plasmid pMClNeo (8), containing a neomycin-resistance gene driven by the Herpes simplex virus thymidine kinase gene (HSV-tk) promoter and a polyoma enhancer, was inserted into this Cla I site by using linkers. Two plasmids, C65.2.3 and C65.5.9, were obtained that differed in the transcriptional orientation of the inserted fragment with respect to that of the P2m gene. The 5' Xho I -Kpn I fragment of each of these was cloned into pUC19 to obtain the targeting vectors used in our experiments. In plasmid C84.4B the 5' to 3' orientation of the neomycin and g32m promoters is identical (see Fig. 1). The opposite configuration occurs in plasmid C84.2D. Culturing, Electroporation, and Selection of ES Cells. The ES cell line E14TG2a (15) was cultured on mitomycin-treated primary embryonic fibroblast-feeder layers essentially as described (16). The embryonic fibroblasts were prepared from embryos from C57BL/6 females that had mated 14-17 days earlier with a male homozygous for a neomycinresistance transgene (17); these cells are capable ofgrowth in medium containing G418. Electroporation conditions were similar to those that have been described (18). ES cells were trypsinized, resuspended in culture medium at 4 x 107 cells per ml, and electroporated in the presence of the targeting DNA at 12 nM in the first experiment and 5 nM DNA in the second. A voltage of 300 V with a capacitance of 150-250 ,uF was found optimal with an electroporation cell of 5 mm length Abbreviations: 932m, ,82-microglobulin; ES cell, embryonic stem cell; PCR, polymerase chain reaction. 8932 The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact. Proc. Natl. Acad. Sci. USA 86 (1989) 8933 and 100 mm2 cross-section (18). Approximately 5 x 106 electroporated cells were plated onto mitomycin-treated fibroblasts in 100-mm dishes containing Dulbecco's modified Eagle's medium (DMEM) supplemented with 15% (vol/vol) fetal bovine serum and 0.1 mM 2-mercaptoethanol. The medium was replaced 24 hr after electroporation with medium containing G418 (200 Ag/ml). Analysis of G418-Resistant ES Cell Colonies. ES colonies visible 10-14 days after electroporation were picked with drawn-out capillary pipettes for analysis using the PCR. Half of each picked colony was saved in 24-well plates already seeded with mitomycin-treated feeder cells. The other halves, combined in pools of three or four colonies, were transferred to Eppendorf tubes containing -0.5 ml ofisotonic phosphate-buffered saline (PBS) and analyzed for homologous recombination by PCR. Conditions for PCR reactions were essentially as described (11). The ES cells were pelleted, resuspended in 5 A.l of PBS, and lysed by the addition of 55 tkl of H20 to each tube. DNases were inactivated by heating each tube at 950C for 10 min. After treatment with proteinase K at 550C for 30 min, 30 ul of each lysate was transferred to a tube containing 20 1.l of a reaction mixture including PCR buffer, each primer at 1.5 ,ug, 3 units of Thermus aquaticus polymerase, 10o (vol/vol) dimethyl sulfoxide, and 0.2 mM dATP, 0.2 mM dCTP, 0.2 mM dGTP, and 0.2 mM dTTP. PCR was carried out for 55 cycles using a thermocycler modeled after one described (8), with a 65-sec melt incubation at 92°C and a 10-min annealing and extension incubation at 65°C. The two priming oligonucleotides, TGGCGGACCGCTATCCCCCAGGAC and GATGCTGATCACATGTCTCG, correspond, respectively, to sequences located 650 bases to the 3' side of the start codon of the neomycin gene and sequences located in exon 3 of the 832m gene. The reaction mixture (20 ,l) was electrophoresed on agarose gels and transferred to nylon membranes (Zeta Bind). Filters were probed with a 32P-labeled 450-bp EcoRI-Kpn I fragment of the 182m gene indicated in Fig. 1 (see below). Preparation and Restriction Enzyme Analysis of Genomic DNA. Genomic DNA was prepared from ES cells, whole new-born mice, and mouse tails by conventional methods. DNA was digested with restriction enzymes as directed by the manufacturers, and fragments were separated on 0.7% agarose gels. DNA was transferred to nylon membranes and probed with the 32P-labeled fragment described above. Embryo Manipulation and Blastocyst Injection. Mice were purchased from either The Jackson Laboratory or Charles River Breeding Laboratories. C57BL/6 blastocysts were obtained from 3to 4-week-old superovulated females. Uteri were flushed with M2 medium (19) 3.5 days after ovulation. Blastocysts were collected, washed several times in fresh M2 medium, and placed in a 100-,lI droplet of M2 under paraffin oil. ES cells were trypsinized, washed once with fresh DMEM, and diluted to -2 x 106cells per ml. Cells (5 ,ul) were