Collagenase Cloning and Characterization of Human Tumor Cell Interstitial

A full-length complementary DNA (cDNA) for interstitial collagenase was isolated from an A2058 melanoma cDNA library using the pCD-X Okayama-Berg vector. The tumor interstitial collagenase cDNA was sequent-eeland compared to the published sequences for human fibroblast collagenase. The sequence for the tumor collagenase has two DNA base pairs which differ from the sequence of normal fibroblast collagenase. Restriction enzyme digestion of a specific DNA fragment produced by polymerase chain reaction amplification of genomic DNA from human placenta resolves a discrepancy in the previously reported DNA and amino acid sequences for the fibroblast collagenase. A high level of expression of interstitial collagenase message was found in human A2058 melanoma cells by Northern blot analysis, and this level was slightly increased by phorbol ester (phorbol myristate acetate) stimulation. Inter stitial collagenase mRNA expression was significantly decreased by treatment with either transforming growth factor-/)! or retinole acid in A2058 melanoma cells. A high level of the collagenase protein secreted into conditioned media was identified by Western blotting. As shown by gelatin zymogram analysis interstitial collagenase was one of at least two metalloproteinases secreted by this same cell line. Thus, human mela noma cells can directly produce interstitial collagenase without a require ment for host cell interaction. INTRODUCTION The collagenase gene family consists of a number of matrixdegrading metalloproteinases. Each member of the family has a different substrate specificity. Type IV collagenase, one mem ber of this family, is thought to play a role in basement mem brane degradation and has been closely linked to the metastatic phenotype (1). However, basement membranes are only one barrier which must be crossed by invading tumor cells. These cells must also traverse interstitial stroma composed of types I and III collagen (2-10). Furthermore, tumor cells may also invade bone and cartilage which are composed principally of types I and II collagen. Collagens pose a significant mechanical barrier to migrating cells (11). Several investigators have proposed that interstitial collagenase is active in migrating cells (12, 13) and is induced in human tumors. Because tumors are heterogeneous with respect to cellular composition, the cell type responsible for the origin of type I collagenase in tumors has not been definitively established for all tumor types. Several immunohistochemical studies suggest that tumor cells do not produce interstitial collagenase and that, instead, it is produced by the surrounding fibroblast cells possibly in response to tumor cell factors (12, 14, 15). Alternatively, other immunohistochemical data pro pose that some tumor cells, including melanoma, could produce interstitial collagenase ( 16). Interstitial collagenolytic activity has been identified in some tumor cell preparations (11, 17). However, the identity of the type I collagen-degrading enzyme associated with tumor cells Received 3/15/90; revised 5/15/90. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1To whom requests for reprints should be addressed, at Laboratory of Pathol ogy, National Cancer Institute, Bldg. 10, Room 2A33, 9000 Rockville Pike, Bethesda, MD 20892. and its possible relationship to interstitial fibroblast collagenase has not been established. The purpose of the present study was to identify and characterize tumor cell-associated type I colla genase activity and compare this enzyme with the well-charac terized fibroblast interstitial collagenase. MATERIALS AND METHODS mRNA Preparation and cDNA Library Construction. Total cellular RNA was prepared from A2058 cells by the guanidine isothiocyanate method (18). The A2058 melanoma cell line was derived from a brain metastasis in a 43-year-old man (19). A2058 RNA was used to prepare a cDNA2 library constructed in the pCD-X Okayama-Berg vector as previously described (20). Screening and Analysis of cDNA Clones. Oligonucleotide probes were synthesized which have homology to the complementary strand of the metal-binding domain of human fibroblast collagenase. These probes include: WSS-15, GAGTCCAAGAGAATGGCCGAGTTCACTAGCCGC; WSS-16, GAGTCCAAGAGAATGGCCGATTCCACTAGCCGC; and WSS-20, GAGTCCAAGAGAATGGCCGAGTCCATGAGCCGC. The probes were 5'-end-labeled (specific activity, 2.5 x 10s cpm/ml) with T4 polynucleotide kinase (18) and [7-32P]ATP (6000 Ci/ mmol; New England Nuclear) and were used to screen 2.5 x 10' colonies. Hybridization and wash conditions were as described previ ously (18), with the temperature of the stringent 6x SSC/0.2% SDS wash set at 58 °C. Positive clones were selected, purified, and rescreened. DNA was prepared from selected clones according to the standard protocol (18). The DNAs were digested with Xhol to determine the size of the inserts. Northern Blot Analysis. Total cytoplasmic RNA was prepared ac cording to the guanidine isothiocyanate method (18) from A2058 melanoma and the following human breast carcinoma cell lines: MDA 231, MDA 435, MCF 7, ras-transformed MCF7, and T47D. All cell lines were obtained from the American Type Culture Collection with the exception of the A2058 melanoma cell line which was developed at the NIH (19) and the raj-transformed MCF-7 cell line which was a gift from Dr. E. Gelman, Lombardi Cancer Center, Georgetown University, Washington, DC. The cell lines were selected to represent a wide spectrum of invasive potential (both estrogen dependent and estrogen independent). Total cytoplasmic RNA (5.0 ¿ig/lane)was electrophoresed on an agarose gel containing 2 M formaldehyde. The RNA was transferred to a GeneScreenPlus membrane (DuPont) overnight using lOx SSC. The RNA blot was washed in 2x SSC and UV cross-linked in a UV Stratalinker 2400 (Stratagene). Prewashing was at 42°Cin l M NaCl, 10 mM Tris, l IHMEDTA, and 0.1% SDS for 2 h. Prehybridization was at 42°Cin 10% dextran sulfate, 4x SSC/40% formamide, 5x Denhardt's solution, 0.1% SDS, and 100 /ig/ml salmon sperm DNA. The p35-l insert was labeled with [a32P]CTP (3000 Ci/mmol; New England Nuclear) by the random primer method, and the blot was hybridized overnight at 42°Cwith 1 x IO6cpm/ml of the labeled probe. A stringent wash was done for 30 min at 65°Cin 0.2x SSC/1% SDS. Treatment of A2058 Cells. Human melanoma A2058 cells were grown in Dulbecco's modified Eagle's medium, supplemented with 0.5% (v/v) ITS* (Collaborative Research, Inc.), for 24 h prior to treatment. Fresh medium containing either 16 nM PMA (Sigma Chem ical Co.), 200 pM TGF-01 (R&D Systems Inc.), or 1 ^M M-trans 2The abbreviations used are: cDNA, complementary DNA; SSC, standard saline citrate; SDS, sodium dodecyl sulfate; PMA, phorbol myristate acetate; TGF, transforming growth factor; TE, 10 mw Tris-HCl, 0.1 mM EDTA, pH 8.0; Thr, threonine; Gly, glycine; Arg, arginine; Ser, serine; His, histidine; Ile, isoleucine. 5431 American Association for Cancer Research Copyright © 1990 on February 23, 2013 cancerres.aacrjournals.org Downloaded from TUMOR INTERSTITIAL COLLAGENASE retinoic acid (Sigma Chemical Co.) was then added. Total cytoplasmic RNA was isolated after 24 h of treatment, and Northern blot analysis was performed. Restriction Map of p35-l. A restriction map of clone p35-l was generated by digestion with the following enzymes: BamH\, Clal, EcoR\, Hind III, Sstl, Sal I, Xbal, and Xhol. Many restriction digests were done using one of these restriction enzymes per digest or using two and three different enzymes simultaneously in a digest (data not shown). There are no restriction sites present within the insert for Hind III, Sail, and Xho\. DNA Sequencing. The sequence analysis was performed on the Genesis 2000 automated sequencer (DuPont) using the fluorescent chain-terminating dideoxynucleotide method (21, 22). The doublestranded DNA dideoxy protocol was followed. Twenty-two oligonucleotide primers (ISmers; NT-l-NT-22) were synthesized which are ho mologous to various regions found on both strands of the human fibroblast collagenase sequence (4, 23). These oligonucleotides were used as primers for the sequencing reactions. Polymerase Chain Reactions and Primers. The polymerase chain reaction (24, 25) was carried out in a total volume of 100 n\ with 2 ^g genomic DNA, 10 ^M of each oligonucleotide primer in 50 mivi KC1, 10 HIM Tris-HCl (pH 8.0), 1.5 mivi MgCl2, 0.01% gelatin, 200 MM dATP, 200 UMdCTP, 200 /IM dGTP, 200 MMdTTP, and 2.5 units of Thermus aquaticus polymerase (Perkin-Elmer/Cetus) for 62 cycles in an automated thermal cycler (Perkin-Elmer/Cetus). The first cycle was 94°Cdenaturation (30 s), 55"C annealing (15 s), and 72°Cextension (1 min). Cycles 2-61 were 94°Cdenaturation (15 s), 55°Cannealing (15s), and 72°Cextension (1 min). The last cycle was 72°Cextension (10 min). The primers used were: NT-4, GGTGATGAAGCAGCCCAG; and NT-15, GTCCACATCTGCTCTTGG. The 5' end of NT-4 begins at base pair 323 of the collagenase cDNA, and the 5' end of NT-15 is found on the complementary strand beginning at base pair 461. On the interstitial collagenase genomic DNA, intron 2, which consists of 90 base pairs, is present after base pair 418 of the fibroblast collagenase cDNA. Therefore, it was predicted that upon amplification of genomic DNA with primers NT-4 and NT-15 a DNA fragment of approximately 229 base pairs would be generated. After amplification, the polymerase chain reaction mixtures were extracted with phenol/chloroform, precipitated with ethanol, washed with 70% ethanol, and resuspended in TE, pH 7.5, as described previ ously (18). Each amplified DNA fragment was digested with Rsal and electrophoresed on a 3% NuSieve/1% agarose gel. Amplified DNA fragments which were not digested with restriction enzyme and Haellldigested 0xl74RF DNA marker were electrophoresed on the same gel with the /fcÃol-digested DNA fragments. The gel was stained with ethidium bromide and visualized with UV. Western Blot Analysis. A2058 melanoma cell-conditioned media (20 /¿I/lane)was electrophoresed on a 10-20% SDS-polyacrylamide gra dient gel. The samples were electroblotted onto Immobilon P mem branes (Millipore) at 30 V constant voltage overnight at 4°Cusing a methanol/Tris-glycine transfer buffer (26). The membrane was incu bated with polyclonal anti-human type I collagenase antibody. The anti type I collagenase antibody was a gift from Dr. H. Brikedahl-Hansen, University of Alabama at Birmingham, Birmingham, AL. Rabbit antisheep horseradish peroxidase conjugate (BioRad) was used as the second antibody. Gelatin Zymogram. Samples of A2058 melanoma cell-conditioned media (20 ¿¿I/lane) were analyzed directly by SDS-polyacrylamide gel electrophoresis on 9% acrylamide gels containing 0.1% gelatin as described previously (27). RESULTS Cloning of Human Melanoma Interstitial Collagenase. An A2058 melanoma cDNA library was constructed in the Okayama-Berg vector, pCD-X. The metal-binding domain of the collagenase enzyme family ¡s highly conserved among all mem bers of this family. To identify any possible collagenases se creted by the human melanoma cell line A2058, we screened a A. 1234 567