Detection and quantification by homogeneous PCR of cell-free fetal DNA in maternal plasma.
چکیده
Prenatal diagnosis of genetic disorders has traditionally relied on invasive procedures such as amniocentesis and chorionic villus sampling (CVS). As these procedures carry a small but significant risk of pregnancy loss, a convenient noninvasive prenatal diagnostic has long been sought. Although fetal cells circulating in the maternal blood have been used for prenatal screening, because of their rarity they require ;10to 10-fold enrichment to be detectable (1 ). Recently, extracellular fetal DNA has been detected in maternal circulation, suggesting that maternal blood might be a useful source of material for noninvasive prenatal diagnosis (2, 3). To quantify fetal DNA in maternal circulation, we established a quantitative, homogeneous TaqMan PCR assay based on fluorogenic probes (4 ). This technique involves continuous monitoring of the progress of amplification and permits target quantification. Such analytical characteristics as precision, sensitivity, and dynamic range were analyzed using human genomic DNA as template. The reproducibility of DNA extraction and PCR amplification was also determined using as target cell-free DNA extracted from pooled plasma. This assay was then tested by determining the genders of adult donors by measuring cell-free DNA in their plasma. Finally, using the male-specific SRY gene as a marker for male fetuses, we successfully determined the gender of all fetuses tested. We collected blood samples from 38 healthy adult volunteers in EDTA. For the fetal DNA study, following approval by the Perinatal Research Committee and the Research Subjects Review Board at the University of Rochester, 30 pregnant patients were enrolled in a prospective trial with masking of those performing all tests. Maternal blood samples were collected before clinically indicated amniocentesis or CVS. Plasma was isolated immediately by centrifugation twice at 1600g for 10 min, and then stored at 280 °C. Fetal gender was known from the karyotype, which was withheld from the molecular laboratory. We processed 2 mL of plasma from healthy adult donors and 5 mL of plasma from pregnant women. Free circulating DNA was extracted by use of the QIAamp DNA Blood Midi method (Qiagen Inc.). DNA was eluted from the column into 250 mL of AE buffer. Triplicate 5-mL aliquots were amplified in each PCR reaction. Amplification was monitored in real-time on a PE ABI 7700 Sequence Detector using the primers and probes below (3 ): SRY forward primer: 59-TGGCGATTAAGTCAAATTCGC-39 SRY reverse primer: 59-CCCCCTAGTACCCTGACAATGTATT-39 SRY TaqMan probe: 59-(VIC)TCTGCCTCCCTGACTGCTCTACTGCT (TAMRA)-39 b-actin forward primer: 59-TCACCCACACTGTGCCCATCTACGA-39 b-actin reverse primer: 59-CAGCGGAACCGCTCATTGCCAATGG-39 b-actin TaqMan probe: 59-(FAM)ATGCCC-X(TAMRA)CCCCCATGCCATCCTGCGT-39