Evaluation of a single nucleotide polymorphism (SNP) and single nucleotide mutation in cancer patients and other diseases is crucial for genotypic characterization in order to select therapy and genetic counseling. The study aim is to develop and optimization for the detection of miR-146a gene rs2910164 C/G polymorphism in breast cancer. Tetra-primer Amplification Refractory Mutation System (T-...

pRSgap (Supplementary Figure 3B) was constructed from pBluescriptII SK+ (Stratagene) by inserting 4 PCR fragments derived from λ-DNA into the multiple cloning site of the vector. PCR fragment 1 (forward primer: AAAATCTAGAAGTTCAGGAAGCGGTGATGCTG, reverse primer AAAAGAGCTCTTGGGCGGTTGTGTACATCGAC) copies the 4236 to 6137 bp region from λ-DNA. After digestion with the corresponding restriction enzyme...

Conventional asymmetric PCR is inefficient and difficult to optimize because limiting the concentration of one primer lowers its melting temperature below the reaction annealing temperature. Linear-After-The-Exponential (LATE)-PCR describes a new paradigm for primer design that renders assays as efficient as symmetric PCR assays, regardless of primer ratio. LATE-PCR generates single-stranded pr...

A very sensitive and specific method for the random amplification of whole DNA molecules and genomes ranging from 400 base pairs (bp) to 40 Megabase (Mb) is described. This simple, two step PCR (1-3) strategy utilizes tagged random primers that consist of a pool of all possible 3' sequences for binding to the target DNA and a constant 5' region for the detection of incorporated primers. As litt...

We have developed a strategy for multiplex PCR based on PCR suppression. PCR suppression allows DNA target amplification with only one sequence-specific primer per target and a second primer that is common for all targets. Therefore, an n-plex PCR would require only n + 1 primers. We have demonstrated uniform, efficient amplification of targeted sequences in 14-plex PCR. The high specificity of...

Background: The pathogenesis of migraine involves immune-mediated mechanisms in the vascular endothelium. Toll like receptor 4 (TLR-4) is a signaling receptor of innate immunity which plays a role in various neuropathologies related to neuron inflammation. Objective: This case/control study is aimed to investigate whether TLR- 4 896A/G variation is related to migraine headaches in an Iranian po...

http://bfw.ac.at/200/1859.html The data collected: A data base is presented which collects published primer information for chloroplast DNA. Additional primers were designed in order to fill gaps were no or little primer information could be found. Chloroplast genes evolve slowly, and many primers have been designed to work across species ('universal primers', e.g. Taberlet et al. 1991, Grivet ...