pRSgap (Supplementary Figure 3B) was constructed from pBluescriptII SK+ (Stratagene) by inserting 4 PCR fragments derived from λ-DNA into the multiple cloning site of the vector. PCR fragment 1 (forward primer: AAAATCTAGAAGTTCAGGAAGCGGTGATGCTG, reverse primer AAAAGAGCTCTTGGGCGGTTGTGTACATCGAC) copies the 4236 to 6137 bp region from λ-DNA. After digestion with the corresponding restriction enzyme...

Conventional asymmetric PCR is inefficient and difficult to optimize because limiting the concentration of one primer lowers its melting temperature below the reaction annealing temperature. Linear-After-The-Exponential (LATE)-PCR describes a new paradigm for primer design that renders assays as efficient as symmetric PCR assays, regardless of primer ratio. LATE-PCR generates single-stranded pr...

The multiplex polymerase chain reaction (MP-PCR) is a quick and an inexpensive technique in molecular biology for amplifying multiple DNA loci in a single Polymerase Chain Reaction (PCR). One of the criteria to achieve highly specific reaction products is to keep the concentration of the amplification primers low. In research, the dilemma associated with primer minimization for MP-PCR reactions...

We have developed a vectorette PCR approach to provide an improved method for isolation of microsatellite repeats. The modified procedure relies on PCR amplification using a vectorette-specific primer in combination with one of a panel of anchored dinucleotide repeat primers. The target DNA to be screened for microsatellite sequences can be from YAC, P1, cosmid, bacteriophage or plasmid clones....

A PCR-based technique based on the ITS1-5.8s-ITS2 domain of the rRNA gene for identifying five species associated with Mycosphaerella leaf disease (MLD) of eucalypts was developed. Primer pairs MC2F and MC2R; ML1F and ML1R; MM1F and MM1R; MN1F and MN1R; and MP1F and MP1R amplified a product for DNA extracted from their single target species, those being M. cryptica, M. lateralis, M. marksii, M....

A very sensitive and specific method for the random amplification of whole DNA molecules and genomes ranging from 400 base pairs (bp) to 40 Megabase (Mb) is described. This simple, two step PCR (1-3) strategy utilizes tagged random primers that consist of a pool of all possible 3' sequences for binding to the target DNA and a constant 5' region for the detection of incorporated primers. As litt...

Theileria annulata, as a pathogenic agent of tropical theileriosis, gives rise annually to serious economic losses in cattle industry of Iran. The carrier cattle, harbouring the latent forms of Theileria annulata, play a major role in infecting tick vectors and in disseminating the infection. The aim of this study was determining the carrier cattle, infected with Theileria annulata in Golestan ...