نتایج جستجو برای: zoster virus vzv
تعداد نتایج: 406069 فیلتر نتایج به سال:
A 9 year old boy developed acute monoarthritis of the left knee concurrent with the appearance of a varicella zoster virus (VZV) rash. Repeated VZV DNA hybridisation of the cells within the synovial fluid and synovial membrane failed to show any evidence of intracellular virus. Virus was isolated from synovial fluid 24 hours after the start of clinical infection but not later. These findings su...
AIMS To report on a case of bilateral retrobulbar optic neuritis in a patient with acquired immune deficiency syndrome (AIDS) caused by varicella-zoster virus (VZV); and to review the literature focusing on: cases reported, epidemiology, pathophysiology, diagnosis and treatment. PRESENTATION OF CASE A 38-year-old woman with AIDS presented with a 10-day history of progressive bilateral visual ...
Mink lung cells (MvILu) are highly susceptible to varicella-zoster virus (VZV). The titres of cell-free VZV suspensions reached 1.0 x 10(7) p.f.u./ml at 3 days post-infection, with subsequent cell degeneration, if MvILu cells were infected with a multiplicity of infectious virus of 0.01 p.f.u./cell. In contrast, during the same period and under the same conditions the titres of cell-free VZV we...
Varicella-zoster virus (VZV) is a member of the Herpesviridae family, primary infection with which causes varicella, more commonly known as chicken pox. Characteristic of members of the alphaherpesvirus subfamily, VZV is neurotropic and establishes latency in sensory neurons. Reactivation of VZV causes herpes zoster, also known as shingles. The most frequent complication following zoster is chr...
UNLABELLED Varicella-zoster virus (VZV) is a human herpesvirus, which during primary infection typically causes varicella (chicken pox) and establishes lifelong latency in sensory and autonomic ganglia. Later in life, the virus may reactivate to cause herpes zoster (HZ; also known as shingles). To prevent these diseases, a live-attenuated heterogeneous vaccine preparation, vOka, is used routine...
Background: Varicella zoster virus (VZV) infection is one of the nosocomial infections and healthcare workers (HCWs) are at high risk group who work in the hospital with likelihood of varicella acquisition or transmission. This study evaluated the VZV seroprevalence in this high risk population in Babol, Iran. Methods: Serological testing for VZV using enzyme linked immunosorbent assay (ELISA)...
Varicella zoster virus (VZV) becomes latent in human ganglia after primary infection. VZV reactivation occurs primarily in elderly individuals, organ transplant recipients, and patients with cancer and AIDS, correlating with a specific decline in cell-mediated immunity to the virus. VZV can also reactivate after surgical stress. The unexpected occurrence of thoracic zoster 2 days before space f...
Background: Varicella zoster virus (VZV) causes chickenpox in children and zoster (zona) in the elderly. Using RFLP-PCR method for detection of VZV specific SNPs ORF38, 54 and 62 could distinguish the profile of VZV isolates. The aim of this study was to investigate enzymatic digestion pattern of VZV ORF38 and ORF54 in chickenpox patients using RFLP technique. <b...
A strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (VZV) DNA was found to be due to an insertion or deletion of DNA sequences at a single site. DNA sequence analysis showed that the nucleotide sequence CCGCCGATGGGGAGGGGGCGCGGTACC is tandemly duplicated a variable number of times in different VZV strains and is responsible for t...
Both varicella and herpes zoster (HZ) can cause severe disease in certain age groups. The cell-mediated immune (CMI) response to the varicella zoster virus (VZV) is critical in preventing a recurrence of VZV. The varicella vaccine has markedly decreased the morbidity and mortality associated with varicella, but concerns linger about the cost and frequency of vaccine administration and the long-...
نمودار تعداد نتایج جستجو در هر سال
با کلیک روی نمودار نتایج را به سال انتشار فیلتر کنید