in the present paper, we consider biflatness of certain classes of semigroupalgebras. indeed, we give a necessary condition for a band semigroup algebra to bebiflat and show that this condition is not sufficient. also, for a certain class of inversesemigroups s, we show that the biflatness of ell^{1}(s)^{primeprime} is equivalent to the biprojectivity of ell^{1}(s).

Technical Appendix Table. PCR primer pairs used to recover whole-genome sequences of gemycircularviruses Primer pair Forward primer sequence 5′3′ Reverse primer sequence 5′3′ HV-GcV1–1 TTATATGCCCAGACGGACCC ATTGTGCGGCGGATAGGATA HV-GcV1–2 CGAATTTAACCCCGGATGCA AAGGATGCCACCCGAATGTA HV-GcV1–3 TTGTTCGATCAGACCACCGA GTTCCTTCCGAGCTACAAGT HV-GcV1–4 TCGATGTTAACTCCCTCCGG GAAACGTGTAGATCGGCGAC HV-GcV2–1 TT...

The main purpose of this paper is to establish a relation between universality of certain P-compactifications of a semitopological semigroup and their corresponding enveloping semigroups. In particular, we show that if we take P to be the property that the enveloping semigroup of a compactification of a semitopological semigroup s is left simple, a group, or the trivial singleton semigroup, t...

The concept of complex fuzzy sets is a generalization of ordinary fuzzy sets. In this paper, we introduce the concept of complex fuzzy subhypergroups ($H_{v}$-subgroups) as well as the concept of complex anti-fuzzy subhypergroups ($H_{v}$-subgroups). We investigate their properties and their relations with the traditional fuzzy (anti-fuzzy) subhypergroups ($H_{v}$-subgroups), and we prove some ...

Algebraic hyperstructures have many applications in various sciences. The main purpose of this paper is to provide a new application of weak hyperstructures in Chemistry. More precisely, we present three different examples of hyperstructures associated to electrochemical cells. In which we prove that our hyperstructures are Hv-semigroups and we present some interesting results.

The aim of this paper is to classify all monogenic ternary semigroups, up to isomorphism. We divide them to two groups: finite and infinite. We show that every infinite monogenic ternary semigroup is isomorphic to the ternary semigroup O, the odd positive integers with ordinary addition. Then we prove that all finite monogenic ternary semigroups with the same index...

This paper studies FA-presentable structures and gives a complete classification of the finitely generated FA-presentable cancellative semigroups. We show that a finitely generated cancellative semigroup is FA-presentable if and only if it is a subsemigroup of a virtually abelian group.