نتایج جستجو برای: hv semigroup

تعداد نتایج: 10259  

پایان نامه :وزارت علوم، تحقیقات و فناوری - دانشگاه فردوسی مشهد - دانشکده علوم 1377

this thesis deals essentially (but not from all aspects) with the extension of the notion of semigroup compactification and the construction of a general theory of semitopological nonaffine (affine) transformation semigroup compactifications. it determines those compactification which are universal with respect to some algebric or topological properties. as an application of the theory, it is i...

Journal: :bulletin of the iranian mathematical society 2013
m. essmaili a. medghalchi

in the present paper, we consider biflatness of certain classes of semigroupalgebras. indeed, we give a necessary condition for a band semigroup algebra to bebiflat and show that this condition is not sufficient. also, for a certain class of inversesemigroups s, we show that the biflatness of ell^{1}(s)^{primeprime} is equivalent to the biprojectivity of ell^{1}(s).

2016
Sébastien Halary Raja Duraisamy Laura Fancello Sonia Monteil-Bouchard Priscilla Jardot Philippe Biagini Frédérique Gouriet Didier Raoult Christelle Desnues

Technical Appendix Table. PCR primer pairs used to recover whole-genome sequences of gemycircularviruses Primer pair Forward primer sequence 5′3′ Reverse primer sequence 5′3′ HV-GcV1–1 TTATATGCCCAGACGGACCC ATTGTGCGGCGGATAGGATA HV-GcV1–2 CGAATTTAACCCCGGATGCA AAGGATGCCACCCGAATGTA HV-GcV1–3 TTGTTCGATCAGACCACCGA GTTCCTTCCGAGCTACAAGT HV-GcV1–4 TCGATGTTAACTCCCTCCGG GAAACGTGTAGATCGGCGAC HV-GcV2–1 TT...

پایان نامه :وزارت علوم، تحقیقات و فناوری - دانشگاه تربیت مدرس 1377

مارتی در سال 1934 مقاله ای در کنفرانس ریاضیدانان استکهلم ارائه داد. او در آن مقاله برای اولین بار مفهوم ابر گروهها را به عنوان تعمیم گروهها معرفی کرد. در سال 1990 و جیوکلیس در چهارمین کنفرانس بین المللی ابر ساختار جبری مفهوم -hv گروهها و -hv حلقه ها را بیان کرد. ابر ساختارها توجه افراد زیادی را به خود جلب کرده است . و آن کارهای بسیار زیبایی بر روی این مفاهیم انجام دادند. ما در این پایان نامه به...

The main purpose of this paper is to establish a relation between universality of certain P-compactifications of a semitopological semigroup and their corresponding enveloping semigroups. In particular, we show that if we take P to be the property that the enveloping semigroup of a compactification of a semitopological semigroup s is left simple, a group, or the trivial singleton semigroup, t...

B. Davvaz M. Al-Tahan

The concept of complex fuzzy sets is a generalization of ordinary fuzzy sets. In this paper, we introduce the concept of complex fuzzy subhypergroups ($H_{v}$-subgroups) as well as the concept of complex anti-fuzzy subhypergroups ($H_{v}$-subgroups). We investigate their properties and their relations with the traditional fuzzy (anti-fuzzy) subhypergroups ($H_{v}$-subgroups), and we prove some ...

Algebraic hyperstructures have many applications in various sciences. The main purpose of this paper is to provide a new application of weak hyperstructures in Chemistry. More precisely, we present three different examples of hyperstructures associated to electrochemical cells. In which we prove that our hyperstructures are Hv-semigroups and we present some interesting results.

The aim of this paper is to classify all monogenic ternary semigroups, up to isomorphism. We divide them to two groups: finite and infinite. We show that every infinite monogenic ternary semigroup is isomorphic to the ternary semigroup O, the odd positive integers with ordinary addition. Then we prove that all finite monogenic ternary semigroups with the same index...

2008
Alan J. Cain Graham P. Oliver Nikola Ruskuc Richard M. Thomas

This paper studies FA-presentable structures and gives a complete classification of the finitely generated FA-presentable cancellative semigroups. We show that a finitely generated cancellative semigroup is FA-presentable if and only if it is a subsemigroup of a virtually abelian group.

نمودار تعداد نتایج جستجو در هر سال

با کلیک روی نمودار نتایج را به سال انتشار فیلتر کنید