A PCR-DGGE primer pair, Tyl2F-Tyl4R, specific to plant parasitic and fungivorous nematodes was designed based on the 18S rRNA gene. The results of community analysis using the primers showed that they are specific to the order Tylenchida. This primer pair detected species belonging to Tylenchida with high sensitivity and high resolution. The number of detected species of plant parasitic and fun...

PCR amplification and sequencing of marker genes are a low-cost technique for monitoring prokaryotic eukaryotic microbial communities across space time but will work optimally only if environmental organisms match primer sequences exactly. In this study, we evaluated how well primers globally distributed short-read oceanic metagenomes.

We used a novel type of primer system, a system that uses stair primers, in which the primer sequences are based on consensus sequences in the DNA polymerase gene of herpesvirus to detect herpesviruses by PCR. A single PCR in a single tube detected the six major herpesviruses that infect the central nervous system: herpes simplex virus type 1 (HSV-1), and type 2 (HSV-2), cytomegalovirus (CMV), ...

A new technique of PCR hot start using oligonucleotide primers with a stem-loop structure is developed here. The molecular beacon oligonucleotide structure without any chromophore addition to the ends was used. The 3'-end sequence of the primers was complementary to the target and five or six nucleotides complementary to the 3'-end were added to the 5'-end. During preparation of the reaction mi...

DogBAC canine BAC library (http://www.dogmap.ch/) was polymerase chain reaction (PCR)-screened. Primers were designed using canine mRNA sequence GenBank accession no. U62093 (primer UP: GACTGAGTACAAACTGGTGG and primer LO: GGGCCTCACCTCTATGGTG). The PCR conditions were established on canine blood genomic DNA, the corresponding PCR product cloned and verified by sequencing. The positive BAC clone ...

The polymerase chain reaction (PCR) (2) has evolved into one of the most powerful and widely used tools in molecular biology. Apart from its application in basic research, the universal nature of the PCR technique has proven extremely useful in the field of medical microbiology for the diagnosis and surveillance of infectious diseases. Although the technique is distinguished by its outstanding ...

We describe a simple method for the cloning of PCR products without the need for post-amplification enzymatic treatment. Tailed PCR primer sets are used to create complementary staggered overhangs on both insert and vector by a post-PCR denaturation-hybridisation reaction. The single-stranded overhangs are designed to allow directional cloning in a ligase-free manner. This 'enzyme-free cloning'...

Klebsiella granulomatis is gram-negative bacteria of the genus Klebsiella which causes sexually transmitted disease (STD) Donovanosis and urinary tract infection in older persons. In the present work, in silico approach for primer designing has been implemented; to gather more information about the bacterium. Primer plays an important role to initiate the process of Polymerase Chain Reaction (P...

Salmonella enterica is a human pathogen with over 2,500 serovars characterized. S. enterica serovars Choleraesuis and Paratyphi C are two globally distributed serovars. We have developed a rapid molecular-typing method to detect serovars Choleraesuis and Paratyphi C in food samples by using a comparative-genomics approach to identify regions unique to each serovar from the sequenced genomes. A ...

Aptamers, or single stranded oligonucleotides, are produced by systematic evolution of ligands by exponential enrichment, abbreviated as SELEX. In the amplification and regeneration step of SELEX technique, dsDNA is conversed to ssDNA. Asymmetric PCR is one of the methods used for the generation of ssDNA. The purpose of this study was to design a random DNA library for selection of aptamers wit...