The genome segment 7 of two Indian isolates of bluetongue virus (BTV) from Avikanagar (BTV-1-western India) and Hyderabad (BTV-Untyped Hyderabad-southern India) was amplified by RT-PCR using two sets of VP7 specific primers. A sequence of 1137 bp comprising the complete coding sequence of the VP7 gene from Avikanagar isolate and a 1154 bp full-length sequence from BTV-UT Hyderabad isolate were ...

in this research work, genetic diversity of 21 wild persian shallot (allium hirtifolium boiss.) accessions from south, southwest, west and center of iran was evaluated using morphological traits as well as aflp markers. results showed that khansar accession had the highest leaf width (5.42 cm), mean leaf number per plant (5.41), bulb diameter (10.84 cm), bulb height (4.95 cm) and mean bulb weig...

Black pomfret Parastromateus niger is a commercially important fishery resource in the Persian Gulf but harvesting its stocks lacks genetic identification of populations. AFLP technique was applied to analyze genetic diversity and population structure of 32 fish from coastal waters of Bandar Abbas, Bushehr and Abadan with 7 EcoRI/MseI primer pair combinations. In total, 381 bands were produced ...

Black pomfret Parastromateus niger is a commercially important fishery resource in the Persian Gulf but harvesting its stocks lacks genetic identification of populations. AFLP technique was applied to analyze genetic diversity and population structure of 32 fish from coastal waters of Bandar Abbas, Bushehr and Abadan with 7 EcoRI/MseI primer pair combinations. In total, 381 bands were produced ...

The molecular variability of ten genotypes of Celosia argentea seeds collected from National Institute of Horticultural Research (NIHORT) and National Centre for Genetic Resources and Biotechnology (NACGRAB) germplasms were evaluated using the Amplified Fragment Length Polymorphism (AFLP) marker. The polymorphism of C. argentea was detected within the population using primer mix of AFLP EcoRI +...

pRSgap (Supplementary Figure 3B) was constructed from pBluescriptII SK+ (Stratagene) by inserting 4 PCR fragments derived from λ-DNA into the multiple cloning site of the vector. PCR fragment 1 (forward primer: AAAATCTAGAAGTTCAGGAAGCGGTGATGCTG, reverse primer AAAAGAGCTCTTGGGCGGTTGTGTACATCGAC) copies the 4236 to 6137 bp region from λ-DNA. After digestion with the corresponding restriction enzyme...

Polymorphism. TaqI restriction fragment length polymorphism (RFLP) in the stearoyl-coenzyme A terminal desaturase ( SCDl) gene of purebred Japanese Black cattle. Source and Description of Probe. A 2.7-kb cDNA insert was excised from a pSp86 clone by digestion with EcoRI and ScaI. The insert contains the complete coding sequence of the rat SCDl gene (Thiede et al., 1986). Method of Detection. Pr...

SOURCE/DESCRIPTION: A 4.0 kb TaqI fragment of cosmid EFD64 isolated by a HBV-3 oligonucleotide (1) was subcloned into AccI site of pUC18. POLYMORPHISM: Mspl identifies 5 allelic VNTR polymorphism with bands between 2.6 and 4.6 kb. Rsal, TaqI, EcoRI, BamHI, Hindlll and Pvull identify the same VNTR polymorphism. FREQUENCY: With Rsal, 80 % heterozygosity were observed in 80 unrelated Caucasians. N...

Messenger RNAs for mouse embryonic globins were purified from yolk sac derived eyrthroid cells in mouse fetuses. Double stranded DNAs complementary to these messengers were synthesized and blunt end ligated to a EcoRI digested and DNA polymerase I repaired pBR322 plasmid. Of the ampicillin resistant transformants, one contained a plasmid with globin-specific cDNA. The inserted sequence is about...