Citation: Müller-Esparza H and Randau L (2017) Commentary: Type I CRISPR-Cas targets endogenous genes and regulates virulence to evade mammalian host immunity. Type-I CRISPR-Cas systems are abundant antiviral defense systems of bacteria and archaea. The hallmark sequences of these systems are short CRISPR RNAs (crRNAs) that contain spacer sequences which guide an interference complex termed Cas...

Androgen receptor (AR) gene has been extensively studied in diverse clinical conditions. In addition to the point mutations, trinucleotide repeat (CAG and GGN) length polymorphisms have been an additional subject of interest and controversy among geneticists. The polymorphic variations in triplet repeats have been associated with a number of disorders, but at the same time contradictory finding...

The state of seafood resources around the world has been declining for last 50 years. There are multiple global, regional, and national regulatory arrangements that make an effort to revert this situation. Marine Stewardship Council (MSC) is a voluntary global instrument, believed foster sustainability in commercial fishing practices. This paper analyzes institutionalization MSC Finland Russia,...

Using in vitro labelling techniques, a tRNAGly from M. mycoides sp. capri PG3 has been shown to have the sequence : pGCAGGUGs4UAGUUUAAUGGCAGAACUUC AGCCUUCCm6AAGCUGAUUGUGAGGGU psi CGAUUCCCUUCACCUGCUCCAOH. The anticodon is UCC and no other tRNAGly has been detected in the crude tRNA isolated from this organism. As is the case with some mitochondrial tRNAs, where the genome size of the organelle i...

AbstractAim of the study Benefit from temozolomide (TMZ) chemotherapy in treatment isocitrate dehydrogenase (IDH)–wild-type glioblastoma is essentially limited to patients with O6-methylguanine DNA methyltransferase (MGMT) promoter–methylated tumours. Recent studies suggested that telomerase reverse transcriptase (TERT) promoter hotspot mutations may h...

BACKGROUND Grand-glass nodule for CT image has thought to be less aggressive tumor in lung cancer. Echinoderm microtubule-associated protein-like 4-anaplastic lymphoma kinase (EML4-ALK)-positive lung cancer presenting with Ground-glass nodules (GGNs) is relatively rare, and few such cases have been reported. CASE PRESENTATION An asymptomatic 56-year-old woman exhibited a 1.1-cm GGN in the low...

In this paper we have investigated a new approach for texture features extraction using co-occurrence matrix from volumetric lung CT image. Traditionally texture analysis is performed in 2D and is suitable for images collected from 2D imaging modality. The use of 3D imaging modalities provide the scope of texture analysis from 3D object and 3D texture feature are more realistic to represent 3D ...

objective: the lrr (leucine rich proteoglycans) is a molecular recognition motif found in proteins with some roles in cell adhesion, signal transduction, dna repair and rna processing. opticin is a member of this family. takanosu et al (2001) detected messenger rna expression of mouse opticin in the eye, heart, brain, testis, thyroid and epididymis by dot blot hybridization. in this study, exp...