in this paper, we study fuzzy substructures in connection withhv-structures. the original idea comes from geometry, especially from thetwo dimensional euclidean vector space. using parameters, we obtain a largenumber of hyperstructures of the group-like or ring-like types. we connect,also, the mentioned hyperstructures with the theta-operations to obtain morestrict hyperstructures, as hv-groups...

Technical Appendix Table. PCR primer pairs used to recover whole-genome sequences of gemycircularviruses Primer pair Forward primer sequence 5′3′ Reverse primer sequence 5′3′ HV-GcV1–1 TTATATGCCCAGACGGACCC ATTGTGCGGCGGATAGGATA HV-GcV1–2 CGAATTTAACCCCGGATGCA AAGGATGCCACCCGAATGTA HV-GcV1–3 TTGTTCGATCAGACCACCGA GTTCCTTCCGAGCTACAAGT HV-GcV1–4 TCGATGTTAACTCCCTCCGG GAAACGTGTAGATCGGCGAC HV-GcV2–1 TT...

The concept of complex fuzzy sets is a generalization of ordinary fuzzy sets. In this paper, we introduce the concept of complex fuzzy subhypergroups ($H_{v}$-subgroups) as well as the concept of complex anti-fuzzy subhypergroups ($H_{v}$-subgroups). We investigate their properties and their relations with the traditional fuzzy (anti-fuzzy) subhypergroups ($H_{v}$-subgroups), and we prove some ...

Hyperventilation (HV) and respiratory alkalosis are associated with hypophosphataemia, although the extent and duration of HV required to produce changes in serum phosphate levels are not known. We sought to characterize the effects of HV, with or without dextrose loading, on serum phosphate levels and other biochemical parameters. HV was monitored by controlling the end-tidal partial pressure ...