نتایج جستجو برای: 47666 ngg

تعداد نتایج: 100  

Journal: :FEMS microbiology letters 2010
Ana Cano-Gómez Evan F Goulden Leigh Owens Lone Høj

Two bacterial strains (DY05(T) and 47666-1) were isolated in Queensland, Australia, from diseased cultured crustaceans Panulirus ornatus and Penaeus monodon, respectively. On the basis of 16S rRNA gene sequence identity, the strains were shown to belong to the Harveyi clade of the genus Vibrio. Multilocus sequence analysis using five housekeeping genes (rpoA, pyrH, topA, ftsZ and mreB) showed t...

2003
Yu Tang Kai-Tao He Zhen Xiang Yongbo Zhang Ning Jing

National geological survey works have characteristics of data enormousness, computing denseness, resource distribution, and applications heterogeneousness. As innovative information infrastructure and service architecture, grid can meet geological survey application requirements by implementing sharing and cooperation of distributed and heterogeneous resources. Based on grid technologies and OG...

Journal: :Proceedings of the National Academy of Sciences of the United States of America 2010
Brice Sagot Marc Gaysinski Mohamed Mehiri Jean-Marie Guigonis Daniel Le Rudulier Geneviève Alloing

The dipeptide N-acetylglutaminylglutamine amide (NAGGN) was discovered in the bacterium Sinorhizobium meliloti grown at high osmolarity, and subsequently shown to be synthesized and accumulated by a few osmotically challenged bacteria. However, its biosynthetic pathway remained unknown. Recently, two genes, which putatively encode a glutamine amidotransferase and an acetyltransferase and are up...

2009
A. B. Munshi Gregory D. Boardman George J. Flick Jean Cobb Robert M. Lane

The accumulation of polychlorinated biphenyls (PCBs), DDTs, chlordanes, BHCs, dieldrin, heptachlor epoxide and other organochlorinated pesticides (OCPs) was measured in the tissues of different edible fishes collected along the Virginia Coast by employing the methods: MSPD (Matrix Solid Phase Dispersion) and GC-ECD (Gas Chromatography with Electron Capture Detector). BHC4s were the most predomi...

Journal: :Nucleic acids research 2004
Ernesto I Gonzalez de Valdivia Leif A Isaksson

The influences on gene expression by codons at positions +2, +3, +5 and +7 downstream of the initiation codon have been compared. Most of the +2 codons that are known to give low gene expression are associated with a higher expression if placed at the later positions. The NGG codons AGG, CGG, UGG and GGG, but not GGN or GNG (where N is non-G), are unique since they are associated with a very lo...

2016
Wadim Kapulkin

associated trinucleotide repeat (NGG)n in Caenorhabditis elegans. Abstract: This work describes the experience with implementation of Streptococcus pyogenes Cas9 nuclease, expressed in C. elegans germline. The described work utilizes guide RNA-unc-22-1000 (GGAGAAGGAGGCGGTGCTGG) designed to target the polyglycine encoding stretch within the unc-22gene embedding the impure trinucleotide (NGG)n PA...

2014
Yuan Gao Guanrong Chen Rosa H. M. Chan

To investigate how consensus is reached on a large self-organized peer-to-peer network, we extended the naming game model commonly used in language and communication to Naming Game in Groups (NGG). Differing from other existing naming game models, in NGG everyone in the population (network) can be both speaker and hearer simultaneously, which resembles in a closer manner to real-life scenarios....

2014

Today, agrigenomics researchers have a wide variety of technologies at their disposal for collecting genetic information. Array-based approaches to SNP screening have been the method of choice in analyzing and associating traits with regions of the genome for many plants and animals. As sequencing costs continue to decline, new approaches that leverage next-generation sequencing (NGS) technolog...

Journal: :Healthcare policy = Politiques de sante 2011
Vanessa Burkoski Joshua Tepper Sue Matthews

In 2007, the Ontario Ministry of Health and Long-Term Care made an investment to support full-time employment for new graduate nurses. This paper describes the collaboration of policy makers and researchers in the creation and implementation of the Nursing Graduate Guarantee (NGG). We provide historical context for the development of the initiative and discuss some of the issues related to its ...

Journal: :PLoS Computational Biology 2009
Vinay Satish Kumar Costas D. Maranas

Genome-scale metabolic reconstructions are typically validated by comparing in silico growth predictions across different mutants utilizing different carbon sources with in vivo growth data. This comparison results in two types of model-prediction inconsistencies; either the model predicts growth when no growth is observed in the experiment (GNG inconsistencies) or the model predicts no growth ...

نمودار تعداد نتایج جستجو در هر سال

با کلیک روی نمودار نتایج را به سال انتشار فیلتر کنید