Plasmid pCXC100 from the Gram-positive bacterium Leifsonia xyli subsp. cynodontis uses a type Ib partition system that includes a centromere region, a Walker-type ATPase ParA and a centromere-binding protein ParB for stable segregation. However, ParB shows no detectable sequence homology to any DNA-binding motif. Here, we study the ParB centromere interaction by structural and biochemical appro...

One of the key features of meiosis is that shugoshin in complex with protein phosphatase 2A (PP2A) protects centromeric cohesin during meiosis I, but not during meiosis II. A new model suggests that a PP2A inhibitor mediates deprotection of centromeric cohesin during meiosis II.

conclusions in patients with chc g1 and receiving combination therapy, itpa snp-based index was an accurate and practical solution for prediction of severe anemia. background single-nucleotide polymorphisms (snp) in the inosine triphosphate pyrophosphatase (itpa) gene correlate with ribavirin (rbv)-induced anemia in patients with chronic hepatitis c (chc) receiving combination therapy. managing...

Background: Neonatal mortality rate is an important health index. The present study was conducted to determine the mortality rate and its causes in neonatal intensive care units (NICUS) in Iran. Methods: Online search was done without time limit until June 2018 in several databases, such as PubMed, Web of Science (ISI), Scopus, Mag...

A double-stranded 9 bp GTGAAAAAG pJ alpha sequence found in human centromeric alpha-satellite DNA and a 28 bp ATGTATATATGTGTATATAGACATAAAT tandemly repeated AT28 sequence found within a cloned neo- centromere DNA have each allowed the affinity purification of a nuclear protein that we have identified as poly(ADP-ribose) polymerase (PARP). Use of other related or unrelated oligonucleotide sequen...

BACKGROUND At meiosis, two successive rounds of chromosome segregation lead to ploidy halving. This is achieved through a stepwise release of sister chromatid cohesion, along chromosome arms to allow homolog segregation at anaphase I and at centromeres to allow sister chromatid segregation at anaphase II. Cohesins, the protein complex that ensures cohesion, must then be protected at centromeres...

Despite their essential role in the process of chromosome segregation in most eukaryotes, centromeric histones show remarkable evolutionary lability. Not only have they been lost in multiple insect lineages, but they have also undergone gene duplication in multiple plant lineages. Based on detailed study of a handful of model organisms including Drosophila melanogaster, centromeric histone dupl...

In an approach to clone and characterize centromeric DNA sequences of Candida albicans by chromatin immunoprecipitation, we have used antibodies directed against an evolutionarily conserved histone H3-like protein, CaCse4p (CENP-A homolog). Sequence analysis of clones obtained by this procedure reveals that only eight relatively small regions (approximately 3 kb each) of the Can. albicans genom...

Centromeric regions in many complex eukaryotic species contain highly repetitive satellite DNAs. Despite the diversity of centromeric DNA sequences among species, the functional centromeres in all species studied to date are marked by CENP-A, a centromere-specific histone H3 variant. Although it is well established that families of multimeric higher-order alpha satellite are conserved at the ce...