نتایج جستجو برای: hv
تعداد نتایج: 4260 فیلتر نتایج به سال:
in this paper, we study fuzzy substructures in connection withhv-structures. the original idea comes from geometry, especially from thetwo dimensional euclidean vector space. using parameters, we obtain a largenumber of hyperstructures of the group-like or ring-like types. we connect,also, the mentioned hyperstructures with the theta-operations to obtain morestrict hyperstructures, as hv-groups...
Technical Appendix Table. PCR primer pairs used to recover whole-genome sequences of gemycircularviruses Primer pair Forward primer sequence 5′3′ Reverse primer sequence 5′3′ HV-GcV1–1 TTATATGCCCAGACGGACCC ATTGTGCGGCGGATAGGATA HV-GcV1–2 CGAATTTAACCCCGGATGCA AAGGATGCCACCCGAATGTA HV-GcV1–3 TTGTTCGATCAGACCACCGA GTTCCTTCCGAGCTACAAGT HV-GcV1–4 TCGATGTTAACTCCCTCCGG GAAACGTGTAGATCGGCGAC HV-GcV2–1 TT...
مارتی در سال 1934 مقاله ای در کنفرانس ریاضیدانان استکهلم ارائه داد. او در آن مقاله برای اولین بار مفهوم ابر گروهها را به عنوان تعمیم گروهها معرفی کرد. در سال 1990 و جیوکلیس در چهارمین کنفرانس بین المللی ابر ساختار جبری مفهوم -hv گروهها و -hv حلقه ها را بیان کرد. ابر ساختارها توجه افراد زیادی را به خود جلب کرده است . و آن کارهای بسیار زیبایی بر روی این مفاهیم انجام دادند. ما در این پایان نامه به...
The concept of complex fuzzy sets is a generalization of ordinary fuzzy sets. In this paper, we introduce the concept of complex fuzzy subhypergroups ($H_{v}$-subgroups) as well as the concept of complex anti-fuzzy subhypergroups ($H_{v}$-subgroups). We investigate their properties and their relations with the traditional fuzzy (anti-fuzzy) subhypergroups ($H_{v}$-subgroups), and we prove some ...
Hyperventilation (HV) and respiratory alkalosis are associated with hypophosphataemia, although the extent and duration of HV required to produce changes in serum phosphate levels are not known. We sought to characterize the effects of HV, with or without dextrose loading, on serum phosphate levels and other biochemical parameters. HV was monitored by controlling the end-tidal partial pressure ...
BACKGROUND AND PURPOSE The reliability of hematoma volume (HV) measurement using the ABC/2 method in multicenter clinical trials is unknown. We determined the accuracy of ABC/2 method as an on-site test in comparison with the gold standard central HV-assessment and semiautomatic HV-assessment. Method- We analyzed data from an acute intracerebral hemorrhage multicenter clinical trial. HV was mea...
نمودار تعداد نتایج جستجو در هر سال
با کلیک روی نمودار نتایج را به سال انتشار فیلتر کنید