نتایج جستجو برای: fins and gills of the fish with wet mount slide and were examined under light microscopy. the morphometrical characterization of gyrodactylus specimens was performed using the measurements and drawings of opisthaptoral hard parts of the parasites. the molecular species description was based on polymerase chain reaction (pcr) of partial sequence of 5.8s region of ribosomal rna (5´cgatcatcggtctctcgaac3´) and partial sequence of internal transcribed spacer2 (its2) of ribosomal rna (5´ttaaggaagaaccactagag3´). results: gyrodactylus species morphology identification was performed using yamaguti (1961) identification key. the nucleotide sequences of the pcr products were compared with genbank sequences. conclusions: based on morphometric analysis and sequencing

تعداد نتایج: 26461041  

Journal: :تحقیقات دامپزشکی 0
شیلا امیدظهیر گروه زیست شناسی دریا، دانشکده علوم دریایی دانشگاه مازندران، بابلسر- ایران حسینعلی ابراهیم زاده موسوی گروه بهداشت و بیماریهای آبزیان، دانشکده دامپزشکی دانشگاه تهران، تهران- ایران پرویز شایان گروه انگل شناسی، دانشکده دامپزشکی دانشگاه تهران، تهران- ایران الهه ابراهیم زاده آبکوه گروه انگل شناسی، دانشکده دامپزشکی دانشگاه تهران، تهران- ایران همایون محمودزاده گروه بهداشت و تغذیه دام وطیور، دانشکده دامپزشکی دانشگاه تهران، تهران- ایران

background: fish are constantly exposed to various pathogens and parasites in particular. gyrodactylus from platyhelminthes is an important monogenean ectoparasite that can cause disease and economical losses to cultured, wild, salt and fresh water and ornamental fish. gyrodactylus appears to be one of the most prevalent parasites of ornamental fish especially in cyprinids. objectives: the pres...

پایان نامه :وزارت علوم، تحقیقات و فناوری - دانشگاه تحصیلات تکمیلی علوم پایه زنجان - دانشکده شیمی 1391

in this thesis a calibration transfer method is used to achieve bilinearity for augmented first order kinetic data. first, the proposed method is investigated using simulated data and next the concept is applied to experimental data. the experimental data consists of spectroscopic monitoring of the first order degradation reaction of carbaryl. this component is used for control of pests in frui...

پایان نامه :وزارت علوم، تحقیقات و فناوری - دانشگاه شاهد - دانشکده علوم پایه 1388

introduction acetic acid bacteria are large group of obligate aerobic gram negative bacteria with the ability to oxidize ethanol to acetic acid (1). they are widely distributed in natural habitats and classified in family acetobacteraceae. members of this family are useful in industrial production of vinegar(2). acetic acid bacteria (aab) can use substrates as glucose, ethanol, lactate or glyc...

پایان نامه :وزارت علوم، تحقیقات و فناوری - دانشگاه رازی - دانشکده علوم 1388

abstract sensitive and precise voltammetric methods for the determination of trace amounts of furaldehydes, mainly as furfural (f) and 5-hydroxymethyl-2-furaldehyde (hmf), in waste waters and other matrices is described. determination of total furaldehyde at < ?g g-1 levels in alkaline buffered aqueous media was individually investigated. by the use of ordinary swv and adsorptive square wave ...

پایان نامه :وزارت علوم، تحقیقات و فناوری - دانشگاه رازی - دانشکده علوم 1388

based on the latest records of typhlops vermicularis merrem, 1820 from iran, this species is distributed in the northern and southern regions of the country. in this study, new records of typhlops vermicularis are presented and it is shown that distribution range of this species is extended towards the eastern and western iran, and according to the new distribution map, it can be assumed that t...

پایان نامه :وزارت علوم، تحقیقات و فناوری - دانشگاه شیراز - دانشکده علوم 1391

in this thesis protic and aprotic ammonium-based ionic liquids were synthesized and their surface tensions were measured in the range of 298-373k. the protics are alkyl ammonium-based ils with the carboxylate (formate, acetate, propionate) anion and aprotics are quaternary ammonium-based ils with bis(trifluoromethylsulfonyl)imide anion. capillary rise method was used for surface tension measure...

پایان نامه :وزارت علوم، تحقیقات و فناوری - دانشگاه گیلان - دانشکده فنی 1393

asymmetric membranes are widely used in many industrial membrane separation processes. the major advantage of membrane filtration over the conventional process is its ability to remove a wider spectrum of particles without using any chemicals. hollow fiber configuration offer many advantages over flat-sheet or tubular membranes. the spinning process of hollow fiber may look simple, yet it is te...

پایان نامه :وزارت علوم، تحقیقات و فناوری - دانشگاه فردوسی مشهد - پژوهشکده ادبیات 1391

the major purpose of this study was to develop the translation teacher competency test (ttct) and examine its construct and predictive validity. the present study was conducted in two phases: a qualitative phase as well as a quantitative phase. in the first phase of the study, the author attempted to find out the major areas of competency required for an academic translation teacher. the second...

پایان نامه :دانشگاه آزاد اسلامی - دانشگاه آزاد اسلامی واحد یزد - دانشکده شیمی 1392

in this study, a simple, rapid and selective method was developed for the determination of dexamethasone. the proposed method is based on inhibitory effect of dexamethasone on the oxidation of orange-g by bromate in sulfuric acid media. the reaction was followed spectrophotometrically at 478.5 nm (?max). under optimum experimental conditions, (72.6 ?mol l-1 of orange-g, 0.76 mol l-1 of h2so4, 0...

پایان نامه :وزارت علوم، تحقیقات و فناوری - دانشگاه تربیت مدرس - دانشکده منابع طبیعی و علوم دریایی 1388

this research was conducted in two protect and destroy region in the middle zagros, in illam province. in order to identification of ecological species group and evaluate density of regeneration, effect of many factors such as protection, vegetation, physiographic factors, physical and chemical properties of soil in study locations were studied. to achieve these purpose number of 54 plots using...

نمودار تعداد نتایج جستجو در هر سال

با کلیک روی نمودار نتایج را به سال انتشار فیلتر کنید